View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3873_low_5 (Length: 225)
Name: NF3873_low_5
Description: NF3873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3873_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 8521835 - 8521876
Alignment:
| Q |
1 |
ttataaaattgtaaaatttcttgtaaaatgggtaaatgatcg |
42 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8521835 |
ttataaaattgtaaaatttcttgtaaaatctgtaaatgatcg |
8521876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University