View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3875_high_6 (Length: 367)

Name: NF3875_high_6
Description: NF3875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3875_high_6
NF3875_high_6
[»] chr4 (31 HSPs)
chr4 (2-357)||(3700436-3700793)
chr4 (1-76)||(25483414-25483489)
chr4 (1-76)||(36608664-36608739)
chr4 (2-89)||(39792850-39792937)
chr4 (2-64)||(15841383-15841445)
chr4 (2-76)||(36629316-36629390)
chr4 (1-76)||(44620431-44620506)
chr4 (1-76)||(54017598-54017673)
chr4 (2-76)||(23817684-23817758)
chr4 (3-76)||(1731650-1731723)
chr4 (15-76)||(43174233-43174294)
chr4 (1-74)||(54936274-54936346)
chr4 (2-74)||(32941128-32941200)
chr4 (1-73)||(54343014-54343086)
chr4 (1-76)||(22183267-22183342)
chr4 (1-68)||(36572097-36572164)
chr4 (1-68)||(50002504-50002571)
chr4 (1-76)||(55933127-55933202)
chr4 (6-73)||(2740783-2740848)
chr4 (5-76)||(3340889-3340960)
chr4 (1-68)||(18932760-18932827)
chr4 (9-76)||(39404104-39404171)
chr4 (1-76)||(41370435-41370510)
chr4 (107-182)||(41921939-41922014)
chr4 (1-68)||(50630766-50630833)
chr4 (2-68)||(4390112-4390178)
chr4 (2-76)||(44621081-44621155)
chr4 (1-75)||(49302984-49303058)
chr4 (6-75)||(10246002-10246071)
chr4 (7-104)||(18879890-18879987)
chr4 (1-49)||(4955347-4955395)
[»] chr1 (26 HSPs)
chr1 (2-76)||(26661527-26661601)
chr1 (1-68)||(37556189-37556256)
chr1 (6-76)||(22077500-22077570)
chr1 (6-68)||(37555812-37555874)
chr1 (2-76)||(48588493-48588567)
chr1 (2-74)||(24600321-24600393)
chr1 (1-104)||(3875308-3875411)
chr1 (4-75)||(22793360-22793431)
chr1 (1-104)||(34364585-34364688)
chr1 (1-76)||(41759561-41759636)
chr1 (1-76)||(45493979-45494054)
chr1 (2-76)||(22077115-22077189)
chr1 (3-68)||(9955989-9956054)
chr1 (3-76)||(14318947-14319020)
chr1 (3-60)||(26661919-26661976)
chr1 (104-180)||(35998176-35998252)
chr1 (1-76)||(44290829-44290905)
chr1 (1-76)||(3537604-3537679)
chr1 (5-76)||(11977362-11977433)
chr1 (5-76)||(31767166-31767237)
chr1 (1-68)||(41157453-41157520)
chr1 (2-68)||(41157070-41157136)
chr1 (2-64)||(47380184-47380246)
chr1 (1-42)||(17294655-17294696)
chr1 (1-74)||(32168705-32168778)
chr1 (1-76)||(41142450-41142526)
[»] chr7 (32 HSPs)
chr7 (1-73)||(30244348-30244420)
chr7 (1-76)||(1085621-1085696)
chr7 (1-68)||(7517658-7517725)
chr7 (1-76)||(34218039-34218114)
chr7 (5-68)||(45434718-45434781)
chr7 (1-68)||(45754793-45754860)
chr7 (2-73)||(30245156-30245223)
chr7 (2-73)||(30253571-30253638)
chr7 (24-76)||(30244453-30244505)
chr7 (1-76)||(37533369-37533444)
chr7 (2-76)||(6054639-6054713)
chr7 (24-74)||(30253671-30253721)
chr7 (3-76)||(23382-23455)
chr7 (1-76)||(14681588-14681661)
chr7 (24-76)||(30245256-30245308)
chr7 (4-76)||(47129450-47129522)
chr7 (1-68)||(11845269-11845336)
chr7 (1-68)||(19122809-19122876)
chr7 (1-40)||(23569043-23569082)
chr7 (1-76)||(37167859-37167934)
chr7 (31-72)||(7517765-7517806)
chr7 (31-72)||(7518031-7518072)
chr7 (1-50)||(7554103-7554152)
chr7 (3-48)||(37345998-37346043)
chr7 (11-76)||(37532756-37532821)
chr7 (3-68)||(45433321-45433386)
chr7 (6-71)||(45755010-45755075)
chr7 (2-50)||(2512582-2512630)
chr7 (8-60)||(24838722-24838774)
chr7 (1-41)||(29157643-29157683)
chr7 (1-73)||(36939741-36939813)
chr7 (5-65)||(41854716-41854776)
[»] chr8 (23 HSPs)
chr8 (1-74)||(5420729-5420802)
chr8 (2-97)||(5915946-5916040)
chr8 (2-73)||(34834955-34835026)
chr8 (1-76)||(41129066-41129141)
chr8 (1-74)||(30441163-30441236)
chr8 (1-76)||(3038295-3038370)
chr8 (2-73)||(3669766-3669837)
chr8 (5-76)||(18371666-18371737)
chr8 (1-72)||(20995425-20995496)
chr8 (3-65)||(147900-147962)
chr8 (7-76)||(3670144-3670213)
chr8 (6-74)||(45121663-45121731)
chr8 (8-68)||(45122070-45122130)
chr8 (5-76)||(40518153-40518224)
chr8 (2-73)||(45122703-45122774)
chr8 (2-76)||(6876867-6876941)
chr8 (9-75)||(37544496-37544562)
chr8 (2-55)||(5274854-5274907)
chr8 (1-74)||(9507860-9507933)
chr8 (8-65)||(12283957-12284014)
chr8 (8-89)||(40518667-40518748)
chr8 (1-74)||(40579276-40579349)
chr8 (1-73)||(1013879-1013951)
[»] chr6 (21 HSPs)
chr6 (2-73)||(10074371-10074442)
chr6 (1-68)||(12085047-12085114)
chr6 (2-76)||(10911645-10911719)
chr6 (7-68)||(12071704-12071765)
chr6 (1-76)||(29518581-29518656)
chr6 (1-76)||(29518998-29519073)
chr6 (1-76)||(32741257-32741332)
chr6 (2-76)||(2843634-2843708)
chr6 (2-68)||(3409338-3409404)
chr6 (2-76)||(10073621-10073695)
chr6 (5-66)||(1950200-1950261)
chr6 (3-76)||(16454987-16455060)
chr6 (1-76)||(1846826-1846901)
chr6 (1-76)||(2578448-2578523)
chr6 (1-76)||(10073996-10074071)
chr6 (2-49)||(12092514-12092561)
chr6 (1-68)||(16107756-16107823)
chr6 (1-76)||(35210282-35210357)
chr6 (2-76)||(14748347-14748417)
chr6 (1-73)||(2377832-2377904)
chr6 (1-41)||(3058304-3058344)
[»] chr2 (29 HSPs)
chr2 (3-76)||(6421811-6421884)
chr2 (7-77)||(7598685-7598755)
chr2 (1-75)||(36178611-36178685)
chr2 (2-55)||(29873563-29873616)
chr2 (1-76)||(962676-962751)
chr2 (1-76)||(3672779-3672854)
chr2 (2-76)||(3673147-3673221)
chr2 (6-68)||(7598311-7598373)
chr2 (6-76)||(40733965-40734035)
chr2 (3-76)||(5542630-5542703)
chr2 (3-76)||(5543003-5543076)
chr2 (11-76)||(6421714-6421779)
chr2 (1-74)||(6422188-6422261)
chr2 (1-76)||(23346314-23346389)
chr2 (1-76)||(37106266-37106341)
chr2 (1-76)||(42514727-42514802)
chr2 (2-76)||(6421464-6421538)
chr2 (1-75)||(15511501-15511575)
chr2 (1-75)||(15880341-15880415)
chr2 (2-76)||(37106003-37106077)
chr2 (7-73)||(40733601-40733667)
chr2 (1-74)||(14745674-14745747)
chr2 (2-58)||(28254262-28254316)
chr2 (2-55)||(30313256-30313309)
chr2 (2-34)||(31468797-31468829)
chr2 (2-46)||(33561486-33561530)
chr2 (2-74)||(36005887-36005959)
chr2 (9-77)||(37632601-37632669)
chr2 (4-48)||(41678401-41678445)
[»] chr5 (22 HSPs)
chr5 (1-73)||(38427625-38427697)
chr5 (1-76)||(624274-624349)
chr5 (1-76)||(6500528-6500603)
chr5 (3-76)||(3295350-3295422)
chr5 (1-73)||(32487471-32487543)
chr5 (6-65)||(623901-623960)
chr5 (1-68)||(26074159-26074226)
chr5 (1-68)||(26074690-26074757)
chr5 (1-76)||(40296320-40296395)
chr5 (2-76)||(6500901-6500975)
chr5 (7-76)||(1028522-1028591)
chr5 (3-76)||(34753030-34753103)
chr5 (1-66)||(41170712-41170777)
chr5 (1-33)||(11417025-11417057)
chr5 (1-81)||(18603120-18603200)
chr5 (5-73)||(26590918-26590986)
chr5 (5-76)||(42405603-42405672)
chr5 (6-76)||(15370182-15370252)
chr5 (1-58)||(35150084-35150141)
chr5 (8-49)||(36522269-36522310)
chr5 (1-73)||(36568577-36568647)
chr5 (2-50)||(36527126-36527174)
[»] chr3 (28 HSPs)
chr3 (1-73)||(39934963-39935035)
chr3 (1-76)||(32589781-32589856)
chr3 (2-76)||(37990644-37990718)
chr3 (1-68)||(22303672-22303739)
chr3 (1-68)||(32462913-32462980)
chr3 (1-68)||(41359778-41359845)
chr3 (2-89)||(42342082-42342169)
chr3 (6-76)||(37990982-37991052)
chr3 (2-76)||(43346796-43346870)
chr3 (1-35)||(46546371-46546405)
chr3 (6-68)||(54017829-54017891)
chr3 (1-73)||(22303963-22304035)
chr3 (2-74)||(22304648-22304720)
chr3 (2-50)||(39336001-39336049)
chr3 (1-73)||(45395661-45395733)
chr3 (3-55)||(47964544-47964596)
chr3 (1-68)||(12114575-12114642)
chr3 (4-55)||(25317239-25317290)
chr3 (1-76)||(33803257-33803332)
chr3 (1-76)||(37726574-37726649)
chr3 (1-76)||(42342393-42342468)
chr3 (1-64)||(52634753-52634816)
chr3 (2-76)||(15772933-15773007)
chr3 (1-75)||(31190087-31190161)
chr3 (6-68)||(54018211-54018273)
chr3 (2-75)||(15773271-15773346)
chr3 (4-76)||(35946603-35946675)
chr3 (8-76)||(50612452-50612520)
[»] scaffold0391 (1 HSPs)
scaffold0391 (1-76)||(1111-1186)
[»] scaffold0702 (1 HSPs)
scaffold0702 (1-73)||(522-594)
[»] scaffold0078 (1 HSPs)
scaffold0078 (2-74)||(5061-5133)


Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 31)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 2 - 357
Target Start/End: Original strand, 3700436 - 3700793
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacggctctct-gaactcctccaatgacct 100  Q
    ||||||||||||||||||  ||||||| |||||| ||||||| |||||| ||| ||||||||||||| ||||||| ||||  ||||||||| | ||||||    
3700436 cattgccttaaggttttggataagagtatgatgtctctctcatttgtgtggttattcaagcctcgatgtggacgg-tctcccgaactcctctagtgacct 3700534  T
101 aacaaaaatcacgacaaaaacgcatcggaaagtatgcaaacatatttttgtgtgttgcaatcccgaaatcaaacacacactttgtagttgtttgaattaa 200  Q
    |||||||||||||||||| ||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
3700535 aacaaaaatcacgacaaacacgcatcagaaagtatgcaaacgtgtttttgtgtgttgcaatcccgaaatcaaacacacactttgtagatgtttgaattaa 3700634  T
201 gtc-nnnnnnnntgcagcaacaataaaatatccatcatgtatggattaagtttgtatcatataggtc-nnnnnnnncatatatgtggggtagatgttagt 298  Q
    |||         |||||||||||||||| ||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||    
3700635 gtcaaaaaaaaatgcagcaacaataaaacatccatcatgtatggattaagtttgtatcatataggtcaaaaaagaacatatatgtggggtagatgttagt 3700734  T
299 tgttaaccttgtcttgaaataagtataacatcttttaggttgggtctggtttgtctgtg 357  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
3700735 tgttaagcttgtcttgaaataagtataacatcttttaggttgggtctggtttgtctgtg 3700793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 25483414 - 25483489
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||| ||||||||||| ||| |||||  ||||||| ||||||| ||||||||| |||||||    
25483414 ccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtggacgg 25483489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 36608739 - 36608664
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||| |||||||||||| ||||||||||| ||| ||||||||| |||| ||||||| ||||||||| |||||||    
36608739 ccattgtcttaaggttttgggtaagagtgtggtgtctctctcactagtgtggttgttctagcctcgatgtggacgg 36608664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 2 - 89
Target Start/End: Complemental strand, 39792937 - 39792850
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacggctctctgaactcc 89  Q
    |||||||||||||||||| ||||||||||| ||| |||||  ||||||| ||||||| ||||||||| |||||||  |||||| ||||    
39792937 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtggacggtcctctgagctcc 39792850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 2 - 64
Target Start/End: Complemental strand, 15841445 - 15841383
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcct 64  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||||| |||| || |||||    
15841445 cattgccttaaggttttgggtaagagtgtgatgtctctctcacttgtgtggttgctctagcct 15841383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 36629316 - 36629390
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||||||| ||||||||||| ||| |||||  ||||||| ||||||| ||||||||| |||||||    
36629316 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtggacgg 36629390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 44620431 - 44620506
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||| ||||||||||||||| |||||  ||||||| ||||||| | ||| ||| |||||||    
44620431 ccattgccttaaggttttgggtaagagtgtgatgtttctcttgcttgtgtggttgttctaaccttgatgtggacgg 44620506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 54017673 - 54017598
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||  ||||||||||||||| |||||  ||| ||| ||||||| ||||||||| |||||||    
54017673 ccattgccttaaggttttaggtaagagtgtgatgtctctcttgcttatgtggttgttctagcctcgatgtggacgg 54017598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 2 - 76
Target Start/End: Complemental strand, 23817758 - 23817684
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||||||| ||||||||||| ||| |||||  || |||| ||||||| ||||||||| |||||||    
23817758 cattgccttaaggttttgggtaagagtgtggtgtctctcttgctagtgtggttgttctagcctcgatgtggacgg 23817684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 76
Target Start/End: Complemental strand, 1731723 - 1731650
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||| ||||||||||| ||| |||||  ||||||| ||||||| |||||| || |||||||    
1731723 attgccttaaggttttgggtaagagtgtggtgtttctcttgcttgtgtggttgttctagcctcaatgtggacgg 1731650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 43174233 - 43174294
Alignment:
15 ttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||| ||||||||||| ||| |||||||||||||| ||||||||||||| ||| |||||||    
43174233 ttttgggtaagagtgtggtgtctctctcacttgtgtggttgttcaagccttgatgtggacgg 43174294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 54936274 - 54936346
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    ||||||||||||||||||| ||||||||||| ||| |||||||| | ||| ||||||| ||||||||| |||||    
54936274 ccattgccttaaggttttgggtaagagtgtggtgtctctctcac-tatgtggttgttctagcctcgatgtggac 54936346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 2 - 74
Target Start/End: Complemental strand, 32941200 - 32941128
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    |||||||||||||||||| |||||||||||| || |||||  ||||||  ||||||| ||||||||| |||||    
32941200 cattgccttaaggttttgggtaagagtgtgacgtctctcttgcttgtgcggttgttctagcctcgatgtggac 32941128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 54343086 - 54343014
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    ||||||||||||||||||| ||||||||||| ||| |||||  |||| || ||||||| ||||||||| ||||    
54343086 ccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgagtggttgttctagcctcgatgtgga 54343014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 22183342 - 22183267
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||||||||  ||||||||||  || ||||||||||||   ||||||| ||||||||| |||||||    
22183342 ccattgccttaaggttttggataagagtgtggcgtctctctcacttgtacggttgttctagcctcgatgtggacgg 22183267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 36572097 - 36572164
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||||||||| || ||||| || ||| |||||| ||||||  |||||||||||||||||    
36572097 ccattgccttaaggttttgggttagagtatggtgtctctctcgcttgtgcggttgttcaagcctcgat 36572164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 50002504 - 50002571
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||||| |||||||||||| ||||||||||| ||| ||||| |||||||  ||||||| |||||||||    
50002504 ccattgtcttaaggttttgggtaagagtgtggtgtctctcttacttgtgcggttgttctagcctcgat 50002571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 55933202 - 55933127
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||| |||||| ||||||||||| ||| ||||| ||||||   ||||||| ||||||||| |||||||    
55933202 ccattgccttaaagttttgggtaagagtgtggtgtctctcttacttgtacagttgttctagcctcgatgtggacgg 55933127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 6 - 73
Target Start/End: Original strand, 2740783 - 2740848
Alignment:
6 gccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    |||||||||||||  |||||||||||  || |||||||||||||  ||||||| ||||||||||||||    
2740783 gccttaaggttttacgtaagagtgtggcgtctctctcacttgtg--gttgttctagcctcgatatgga 2740848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 5 - 76
Target Start/End: Original strand, 3340889 - 3340960
Alignment:
5 tgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||| ||||||||||| ||| | |||  ||||||  ||||||| ||||||||| |||||||    
3340889 tgccttaaggttttgggtaagagtgtggtgtctttcttgcttgtggggttgttctagcctcgatgtggacgg 3340960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 18932827 - 18932760
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||||||||  ||||||||||| ||| ||||| ||||| || ||||||  |||||||||    
18932827 ccattgccttaaggttttaggtaagagtgtggtgtctctcttacttgagtggttgttatagcctcgat 18932760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 9 - 76
Target Start/End: Original strand, 39404104 - 39404171
Alignment:
9 ttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||| |||||||||||  || |||||  ||||||| ||||||| ||||||||| |||||||    
39404104 ttaaggttttgggtaagagtgtggcgtctctcttgcttgtgtggttgttctagcctcgatgtggacgg 39404171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 41370435 - 41370510
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||| |||||| ||||||||||  ||| |||||  |||| || ||||||| ||||||||| |||||||    
41370435 ccattgccttaaagttttgggtaagagtgtagtgtctctcttgcttgagtggttgttctagcctcgatgtggacgg 41370510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 107 - 182
Target Start/End: Complemental strand, 41922014 - 41921939
Alignment:
107 aatcacgacaaaaacgcatcggaaagtatgcaaacatatttttgtgtgttgcaatcccgaaatcaaacacacactt 182  Q
    ||||||| |||||| |||| ||||||| ||||||| | ||||||||||||||||    ||||||||||| ||||||    
41922014 aatcacggcaaaaatgcattggaaagtgtgcaaacgtgtttttgtgtgttgcaaagaggaaatcaaacatacactt 41921939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 50630833 - 50630766
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||||||||| ||||||||||| ||| |||||  ||||||  ||||||  |||||||||    
50630833 ccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttttagcctcgat 50630766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 68
Target Start/End: Complemental strand, 4390178 - 4390112
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||||| ||||||||||| |||||||||||| || |||||  ||||||  ||||||| |||||||||    
4390178 cattgcgttaaggttttgggtaagagtgtgacgtctctcttgcttgtgcagttgttctagcctcgat 4390112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 44621081 - 44621155
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||| |||||||||||| ||||||||||| ||| |||||  ||||||  ||| ||| ||||||||| |||||||    
44621081 cattgtcttaaggttttgggtaagagtgtggtgtttctcttgcttgtgcggttattctagcctcgatgtggacgg 44621155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 49302984 - 49303058
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacg 75  Q
    ||||||||||||||||||| ||||||||||| ||| ||||| |||| ||   |||||| | ||||||| ||||||    
49302984 ccattgccttaaggttttgggtaagagtgtggtgtatctcttacttatgcgattgttctatcctcgatgtggacg 49303058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 6 - 75
Target Start/End: Original strand, 10246002 - 10246071
Alignment:
6 gccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacg 75  Q
    |||||||||||||| ||||||||||| ||| || ||  ||||| | ||||||| ||||||||| ||||||    
10246002 gccttaaggttttgggtaagagtgtggtgtctcccttgcttgtctggttgttctagcctcgatgtggacg 10246071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 7 - 104
Target Start/End: Original strand, 18879890 - 18879987
Alignment:
7 ccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacggctctctgaactcctccaatgacctaaca 104  Q
    ||||||||||||| |||||||||||| || ||| |   |||||| ||||||| ||| ||||| |||||||  ||| || |||| ||||||||| ||||    
18879890 ccttaaggttttgggtaagagtgtgacgtctcttttggttgtgtggttgttctagcttcgatgtggacggtcctccgagctcccccaatgacccaaca 18879987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 4955395 - 4955347
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtg 49  Q
    ||||||||||||||||||| |||||||||||  || ||||| |||||||    
4955395 ccattgccttaaggttttgggtaagagtgtggcgtctctcttacttgtg 4955347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 26)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 2 - 76
Target Start/End: Complemental strand, 26661601 - 26661527
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||||||| ||||||||||| ||| |||||| ||||||| |||||||||||||||||||||||||    
26661601 cattgccttaaggttttgggtaagagtgtggtgtctctctcgcttgtgtggttgttcaagcctcgatatggacgg 26661527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 37556189 - 37556256
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||| |||||||||||||| ||||||||||| ||| |||||  ||||||| |||||||||||||||||    
37556189 ccatagccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttcaagcctcgat 37556256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 6 - 76
Target Start/End: Complemental strand, 22077570 - 22077500
Alignment:
6 gccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||| |||||||||||  || |||||||||| ||  ||||||||||| |||||||||||||    
22077570 gccttaaggttttgggtaagagtgtggcgtctctctcacttatgcggttgttcaagcatcgatatggacgg 22077500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 37555812 - 37555874
Alignment:
6 gccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||||||||||||| ||||||||||| ||| |||||  ||||||| |||||||||||||||||    
37555812 gccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttcaagcctcgat 37555874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 2 - 76
Target Start/End: Complemental strand, 48588567 - 48588493
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||||||| ||||||||| | ||| ||||| |||||||  ||||||| ||||||||| |||||||    
48588567 cattgccttaaggttttgggtaagagtgcggtgtctctcttacttgtgcggttgttctagcctcgatgtggacgg 48588493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 2 - 74
Target Start/End: Complemental strand, 24600393 - 24600321
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    ||||| |||||||||||||||||||||||| ||| |||||| || || | ||||||| ||||||||| |||||    
24600393 cattgtcttaaggttttgtgtaagagtgtggtgtctctctcgctagtatggttgttctagcctcgatgtggac 24600321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 3875411 - 3875308
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacggctctctgaactcctccaatgacct 100  Q
    ||||||||||||||||||  |||||| ||||  || ||||||||| |||| ||||||| ||||||||| |||||||  ||| || |||| |  |||||||    
3875411 ccattgccttaaggttttaggtaagaatgtggagtctctctcactagtgtggttgttctagcctcgatgtggacggtcctccgagctcccctcatgacct 3875312  T
101 aaca 104  Q
    ||||    
3875311 aaca 3875308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 4 - 75
Target Start/End: Original strand, 22793360 - 22793431
Alignment:
4 ttgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacg 75  Q
    |||||||| ||||||| |||||||||||| || ||||| |||||||| |||||||  ||||| |||||||||    
22793360 ttgccttacggttttgagtaagagtgtgacgtctctcttacttgtgtggttgttctggcctcaatatggacg 22793431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 34364585 - 34364688
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacggctctctgaactcctccaatgacct 100  Q
    |||| |||||||||||||| ||||||||||||||| |||||| ||| ||  |||| || ||||||||| |||| || || |||| |||| ||| |||||     
34364585 ccatagccttaaggttttgggtaagagtgtgatgtctctctcgcttatgcggttgctctagcctcgatgtggatggttccctgagctcccccagtgaccc 34364684  T
101 aaca 104  Q
    ||||    
34364685 aaca 34364688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 41759561 - 41759636
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||| ||||||||||| ||| |||||  ||| ||| ||||||| ||||| ||| |||||||    
41759561 ccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttatgtggttgttctagccttgatgtggacgg 41759636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 45494054 - 45493979
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||| ||||||  |||||||||| ||| |||||  ||| ||| ||||||||||||||||| |||||||    
45494054 ccattgccttaaagttttggataagagtgtggtgtctctcttccttatgtggttgttcaagcctcgatgtggacgg 45493979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 76
Target Start/End: Complemental strand, 22077189 - 22077115
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||| ||||||||||  ||||||||||| || || ||||||| ||  ||||||||||||||||| |||||||    
22077189 cattgccctaaggttttggataagagtgtgacgtctccctcacttatgcggttgttcaagcctcgatgtggacgg 22077115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 68
Target Start/End: Original strand, 9955989 - 9956054
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||||||| ||||||||||||||| |||||  ||||||  |||| || |||||||||    
9955989 attgccttaaggttttgggtaagagtgtgatgtctctcttgcttgtgcggttgctctagcctcgat 9956054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 76
Target Start/End: Original strand, 14318947 - 14319020
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||| ||||||||||| ||| ||||| | |||||  ||||||| |||||| || |||||||    
14318947 attgccttaaggttttgggtaagagtgtggtgtctctcttatttgtgcggttgttctagcctcaatgtggacgg 14319020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 60
Target Start/End: Complemental strand, 26661976 - 26661919
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaa 60  Q
    ||||||||||||||||| ||||||||||| ||| |||||  ||||||| |||||||||    
26661976 attgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttcaa 26661919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 104 - 180
Target Start/End: Original strand, 35998176 - 35998252
Alignment:
104 aaaaatcacgacaaaaacgcatcggaaagtatgcaaacatatttttgtgtgttgcaatcccgaaatcaaacacacac 180  Q
    ||||||||||||||||||||||| | ||| |||||||| |  |||||||| |||||| |  ||||||||||| ||||    
35998176 aaaaatcacgacaaaaacgcatcaggaagcatgcaaacgtgcttttgtgtattgcaaacgggaaatcaaacaaacac 35998252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 44290905 - 44290829
Alignment:
1 ccattgccttaaggttttgtgt-aagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||| || ||||||||| ||| |||||  ||||||  ||||||| ||||||||| |||||||    
44290905 ccattgccttaaggttttgggtaaagagtgtggtgtatctcttgcttgtgcggttgttctagcctcgatgtggacgg 44290829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 3537679 - 3537604
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||| |||||||||||| |||||||||||  || |||||  ||||||  ||||||| ||||||||| |||||||    
3537679 ccattggcttaaggttttgggtaagagtgtggcgtctctcttgcttgtgcggttgttctagcctcgatgtggacgg 3537604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 5 - 76
Target Start/End: Original strand, 11977362 - 11977433
Alignment:
5 tgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||| ||||||||||||||| |||||  |  |||  ||||||| ||||||||| |||||||    
11977362 tgccttaaggttttgggtaagagtgtgatgtctctcttgcaagtgcggttgttctagcctcgatgtggacgg 11977433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 5 - 76
Target Start/End: Complemental strand, 31767237 - 31767166
Alignment:
5 tgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||| |||||||||||| || | |||  ||||||| ||||||| || |||||| |||||||    
31767237 tgccttaaggttttgggtaagagtgtgacgtctatcttgcttgtgtggttgttctagactcgatgtggacgg 31767166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 41157453 - 41157520
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||||||||| |||||||| ||||||||||| ||| | |||  ||||||| ||||||| |||||||||    
41157453 ccattgcctttaggttttgagtaagagtgtggtgtctgtcttgcttgtgtggttgttctagcctcgat 41157520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 68
Target Start/End: Original strand, 41157070 - 41157136
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||||| ||||||||||| ||||||||||| ||| ||| |  ||||||| ||||||| |||||||||    
41157070 cattgctttaaggttttgggtaagagtgtggtgtctctattgcttgtgtggttgttctagcctcgat 41157136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 64
Target Start/End: Complemental strand, 47380246 - 47380184
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcct 64  Q
    ||||||||||| |||||| ||||||||||||  | |||||||||||| | |||| ||||||||    
47380246 cattgccttaaagttttgggtaagagtgtgacatctctctcacttgtctggttgctcaagcct 47380184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 17294655 - 17294696
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctc 42  Q
    ||||||||||||||||||| ||||||||||| ||| ||||||    
17294655 ccattgccttaaggttttgggtaagagtgtggtgtctctctc 17294696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 32168778 - 32168705
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    |||||||||| |||||||| |||||||||||  || |||||  ||||||  ||||||| ||||||||| |||||    
32168778 ccattgccttgaggttttgggtaagagtgtggcgtctctcttgcttgtgcggttgttctagcctcgatgtggac 32168705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 41142450 - 41142526
Alignment:
1 ccattgccttaaggttttgtgt-aagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||  || |||||||||  || |||||  ||||||| ||||||| ||||||||| |||||||    
41142450 ccattgccttaaggtttttggtaaagagtgtggcgtctctcttgcttgtgtggttgttctagcctcgatgtggacgg 41142526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 32)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 30244348 - 30244420
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    ||||||||||||||||||| ||||||||||| ||| |||||||||||||| ||||||||||||||||| ||||    
30244348 ccattgccttaaggttttgggtaagagtgtggtgtctctctcacttgtgtggttgttcaagcctcgatgtgga 30244420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 1085696 - 1085621
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||| |||||||||||  || ||||| |||||||| ||||||| ||||||||| |||||||    
1085696 ccattgccttaaggttttgggtaagagtgtggcgtctctcttacttgtgtggttgttctagcctcgatgtggacgg 1085621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 7517658 - 7517725
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||||||||| ||||||||||| ||| | |||||||||||| ||||||| |||||||||    
7517658 ccattgccttaaggttttgggtaagagtgtggtgtctgtctcacttgtgtggttgttctagcctcgat 7517725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 34218114 - 34218039
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||| |||||||||||| ||||||||||| ||| |||||| ||||| | ||||||||||||||||| |||||||    
34218114 ccattgtcttaaggttttgggtaagagtgtggtgtctctctcgcttgtatggttgttcaagcctcgatgtggacgg 34218039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 5 - 68
Target Start/End: Original strand, 45434718 - 45434781
Alignment:
5 tgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||||| ||||||||||||||| ||||| |||||||  ||||||| |||||||||    
45434718 tgccttaaggttttgggtaagagtgtgatgtctctcttacttgtggagttgttctagcctcgat 45434781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 45754793 - 45754860
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||| |||||||||||||| ||||||||||| ||| |||||  ||||||| |||||||||||||||||    
45754793 ccatagccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttcaagcctcgat 45754860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 73
Target Start/End: Original strand, 30245156 - 30245223
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    |||||||||||||||||| |||||||||||  ||||||||  ||||||| ||||||||||||||||| ||||    
30245156 cattgccttaaggttttgggtaagagtgtg--gtgtctct--cttgtgtggttgttcaagcctcgatgtgga 30245223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 73
Target Start/End: Original strand, 30253571 - 30253638
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    |||||||||||||||||| |||||||||||  ||||||||  ||||||| ||||||||||||||||| ||||    
30253571 cattgccttaaggttttgggtaagagtgtg--gtgtctct--cttgtgtggttgttcaagcctcgatgtgga 30253638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 30244453 - 30244505
Alignment:
24 agagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||| ||| |||||||||||||| ||||||||||||||||| |||||||    
30244453 agagtgtggtgtctctctcacttgtgtggttgttcaagcctcgatgtggacgg 30244505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 37533444 - 37533369
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||| ||||||||||| ||| ||| |  ||||||  ||||||| ||||||||| |||||||    
37533444 ccattgccttaaggttttgggtaagagtgtggtgtctcttttgcttgtgcggttgttctagcctcgatgtggacgg 37533369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 6054639 - 6054713
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||||||| ||||||||||| ||| ||||  |||||| | ||||||| ||||| ||| |||||||    
6054639 cattgccttaaggttttgggtaagagtgtggtgtctctcctacttgtatggttgttctagccttgatgtggacgg 6054713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 24 - 74
Target Start/End: Original strand, 30253671 - 30253721
Alignment:
24 agagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    |||||||| ||| |||||||||||||| ||||||||||||||||| |||||    
30253671 agagtgtggtgtctctctcacttgtgtggttgttcaagcctcgatgtggac 30253721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 76
Target Start/End: Complemental strand, 23455 - 23382
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||| ||||||||||| ||| |||||  | ||||  ||||||| ||||||||| |||||||    
23455 attgccttaaggttttgggtaagagtgtggtgtctctcttgcatgtgcggttgttctagcctcgatttggacgg 23382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 14681588 - 14681661
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||| |||||||||||| |||||||||||  |||||||||||  |||| ||||||| ||||| ||| |||||||    
14681588 ccattgtcttaaggttttgggtaagagtgtg--gtgtctctcacaagtgtggttgttctagccttgatgtggacgg 14681661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 30245256 - 30245308
Alignment:
24 agagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||| ||| |||||||||||||| |||||||||||||| || |||||||    
30245256 agagtgtggtgtctctctcacttgtgtggttgttcaagcctcaatgtggacgg 30245308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 4 - 76
Target Start/End: Original strand, 47129450 - 47129522
Alignment:
4 ttgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||||| ||||||||||| ||| |||||  ||||||  |||| || ||||||||| |||||||    
47129450 ttgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgatctagcctcgatgtggacgg 47129522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 11845269 - 11845336
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||||||||||||||||||  |||||||||| ||| |||||  ||||||  ||||||| |||||||||    
11845269 ccattgccttaaggttttggataagagtgtggtgtctctcttgcttgtgcagttgttctagcctcgat 11845336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 19122809 - 19122876
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||||||||| ||||||||||| ||| | |||  ||||||| ||||||| || ||||||    
19122809 ccattgccttaaggttttgggtaagagtgtggtgtctatcttgcttgtgtggttgttctagtctcgat 19122876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 23569082 - 23569043
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctc 40  Q
    ||||||||||||||||||| ||||||||||||||| ||||    
23569082 ccattgccttaaggttttgggtaagagtgtgatgtctctc 23569043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 37167859 - 37167934
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||| ||||| |||||| ||||||||||| ||| |||||  ||||||  ||||||| ||||||||| |||||||    
37167859 ccattgacttaaagttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacgg 37167934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 72
Target Start/End: Original strand, 7517765 - 7517806
Alignment:
31 gatgtgtctctcacttgtgtcgttgttcaagcctcgatatgg 72  Q
    ||||| |||||||||||||| ||||||| |||||||||||||    
7517765 gatgtctctctcacttgtgtggttgttctagcctcgatatgg 7517806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 72
Target Start/End: Original strand, 7518031 - 7518072
Alignment:
31 gatgtgtctctcacttgtgtcgttgttcaagcctcgatatgg 72  Q
    ||||| |||||||||||||| ||||||| |||||||||||||    
7518031 gatgtctctctcacttgtgtggttgttctagcctcgatatgg 7518072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 7554103 - 7554152
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgt 50  Q
    |||| |||||||||||||| ||||||||||| ||| |||||| |||||||    
7554103 ccatagccttaaggttttgggtaagagtgtggtgtctctctcgcttgtgt 7554152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 48
Target Start/End: Original strand, 37345998 - 37346043
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgt 48  Q
    |||||||||| |||||| |||||||||||| || ||||||||||||    
37345998 attgccttaaagttttgagtaagagtgtgacgtctctctcacttgt 37346043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 76
Target Start/End: Complemental strand, 37532821 - 37532756
Alignment:
11 aaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||| ||||||||||| ||| |||||  ||||||  ||||||| ||||||||| |||||||    
37532821 aaggttttgggtaagagtgtggtgtctctctagcttgtgctgttgttctagcctcgatgtggacgg 37532756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 68
Target Start/End: Original strand, 45433321 - 45433386
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||| ||||| ||||||||||| ||| |||||  ||||||  ||||||| |||||||||    
45433321 attgccttaagattttgggtaagagtgtggtgtctctcttgcttgtggggttgttctagcctcgat 45433386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 6 - 71
Target Start/End: Original strand, 45755010 - 45755075
Alignment:
6 gccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatg 71  Q
    |||||||  ||||| |||| |||||| ||| || || |||||||| ||||||||||||||||||||    
45755010 gccttaaaattttgggtaaaagtgtggtgtctcccttacttgtgtggttgttcaagcctcgatatg 45755075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 50
Target Start/End: Original strand, 2512582 - 2512630
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgt 50  Q
    ||||| |||||  ||||||||||||||||||| | ||||||||||||||    
2512582 cattgtcttaatattttgtgtaagagtgtgatatatctctcacttgtgt 2512630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 60
Target Start/End: Complemental strand, 24838774 - 24838722
Alignment:
8 cttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaa 60  Q
    |||||||||||| |||||||||||| || |||||  ||||||| |||||||||    
24838774 cttaaggttttgggtaagagtgtgacgtctctcttgcttgtgtggttgttcaa 24838722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 29157643 - 29157683
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctct 41  Q
    ||||||||||||||||||| ||||||||||| ||| |||||    
29157643 ccattgccttaaggttttgggtaagagtgtggtgtctctct 29157683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 36939813 - 36939741
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    ||||||||||||||||||| |||| |||||| ||| |||||  ||| ||  ||||||| ||||||||| ||||    
36939813 ccattgccttaaggttttgggtaaaagtgtggtgtttctcttgcttatgcggttgttctagcctcgatgtgga 36939741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 5 - 65
Target Start/End: Original strand, 41854716 - 41854776
Alignment:
5 tgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctc 65  Q
    ||||||||||||||| |||||||||||| || | ||| |||||||  ||||||| ||||||    
41854716 tgccttaaggttttgggtaagagtgtgacgtctttcttacttgtgcggttgttctagcctc 41854776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 23)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 5420729 - 5420802
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    |||||||||||||||||| ||||||||||||| || || ||||||||||| ||||||||||||||||| |||||    
5420729 ccattgccttaaggttttttgtaagagtgtgacgtctccctcacttgtgtggttgttcaagcctcgatgtggac 5420802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 2 - 97
Target Start/End: Original strand, 5915946 - 5916040
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacggctctctgaactcctccaatga 97  Q
    |||||||||||||||||| ||||||||||| ||| |||||  ||||||  ||||||| ||||||||| ||||||| || | ||||||| |||||||    
5915946 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacgg-tccccgaactcccccaatga 5916040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 2 - 73
Target Start/End: Original strand, 34834955 - 34835026
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    |||||||||||||||||| ||||||||||| ||| |||||  ||||||| ||||||| ||||||||| ||||    
34834955 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtgga 34835026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 41129066 - 41129141
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||| |||||||||||| ||| ||||||| ||| ||||| |||||||| ||||||||| ||||||| |||||||    
41129066 ccattgtcttaaggttttgggtatgagtgtggtgtctctcttacttgtgtggttgttcaaacctcgatgtggacgg 41129141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 30441163 - 30441236
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    ||||||||||||||||||| ||||||||||| ||| |||||  ||||||  ||||||| ||||||||| |||||    
30441163 ccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggac 30441236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 3038370 - 3038295
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||| |||||||||||   | |||||  ||||||| ||||||| ||||||||| |||||||    
3038370 ccattgccttaaggttttgggtaagagtgtggcatctctcttgcttgtgtggttgttctagcctcgatgtggacgg 3038295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 2 - 73
Target Start/End: Original strand, 3669766 - 3669837
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    |||||||||||||||||| ||||||||||| ||| |||||  ||||||  ||||||| ||||||||| ||||    
3669766 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 3669837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 5 - 76
Target Start/End: Complemental strand, 18371737 - 18371666
Alignment:
5 tgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||| ||||||||||| ||||||||||| |||||  |||| || ||| ||||| |||||||    
18371737 tgccttaaggttttgggtaagagtgtggtgtgtctctcatttgtgcggttgctctagcttcgatgtggacgg 18371666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 20995496 - 20995425
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgg 72  Q
    ||||||||||||||||||| |||||| |||| ||| |||||||||||||| |||| ||  |||| |||||||    
20995496 ccattgccttaaggttttgggtaagaatgtggtgtctctctcacttgtgtggttgctctggcctagatatgg 20995425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 3 - 65
Target Start/End: Original strand, 147900 - 147962
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctc 65  Q
    ||||||||||||||||| ||||||||||| ||| ||||| |||||||  ||||||| ||||||    
147900 attgccttaaggttttgggtaagagtgtggtgtctctcttacttgtgcagttgttctagcctc 147962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 7 - 76
Target Start/End: Original strand, 3670144 - 3670213
Alignment:
7 ccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||| ||||||||||| ||| |||||  ||||||  ||||||| ||||||||| |||||||    
3670144 ccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacgg 3670213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 6 - 74
Target Start/End: Complemental strand, 45121731 - 45121663
Alignment:
6 gccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    |||||||||||||| ||||||||||||| | ||||| |||| ||  ||||||| ||||||||| |||||    
45121731 gccttaaggttttgagtaagagtgtgatatctctcttacttatggggttgttctagcctcgatgtggac 45121663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 45122130 - 45122070
Alignment:
8 cttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||||||||||| ||||||||||| ||| ||||| |||||||  ||||||| |||||||||    
45122130 cttaaggttttgggtaagagtgtggtgtctctcttacttgtggggttgttctagcctcgat 45122070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 5 - 76
Target Start/End: Original strand, 40518153 - 40518224
Alignment:
5 tgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||| |||||||||||  || |||||  ||||||| ||||||| ||||| ||| |||||||    
40518153 tgccttaaggttttgggtaagagtgtggcgtctctcttgcttgtgtggttgttctagccttgatgtggacgg 40518224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 2 - 73
Target Start/End: Original strand, 45122703 - 45122774
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    ||||| |||||||||||| ||| |||||||  || |||||  ||||||| ||||||||||||||||| ||||    
45122703 cattgtcttaaggttttgggtatgagtgtggcgtctctcttgcttgtgtggttgttcaagcctcgatgtgga 45122774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 76
Target Start/End: Complemental strand, 6876941 - 6876867
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||| |||| ||||||| ||||||||||| ||| |||||   |||||| ||||||| ||||||||| |||||||    
6876941 cattgtcttagggttttgggtaagagtgtggtgtttctcttgtttgtgtggttgttctagcctcgatgtggacgg 6876867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 9 - 75
Target Start/End: Complemental strand, 37544562 - 37544496
Alignment:
9 ttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacg 75  Q
    ||||||||||| ||||||||||| ||| | ||| |||||||  ||||||| ||||||||| ||||||    
37544562 ttaaggttttgggtaagagtgtggtgtctttcttacttgtgcggttgttctagcctcgatgtggacg 37544496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 55
Target Start/End: Original strand, 5274854 - 5274907
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttg 55  Q
    |||||||||||| ||||| ||||||||||||||| ||| || ||||||| ||||    
5274854 cattgccttaagattttgagtaagagtgtgatgtctctatcgcttgtgttgttg 5274907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 9507860 - 9507933
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    ||||| ||||||||||||| |||||||||||  || ||| || ||| | | ||||||||||||||||| |||||    
9507860 ccattaccttaaggttttgggtaagagtgtggcgtctctatctcttatatggttgttcaagcctcgatgtggac 9507933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 12283957 - 12284014
Alignment:
8 cttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctc 65  Q
    ||||||||||||  |||||||||  ||| |||||||||||||| ||||||| ||||||    
12283957 cttaaggttttggataagagtgtagtgtctctctcacttgtgtggttgttctagcctc 12284014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 40518667 - 40518748
Alignment:
8 cttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacggctctctgaactcc 89  Q
    |||||||||||| |||||||||||| ||  ||||  ||||||| ||||||| |||||| || |||||||  |||||| ||||    
40518667 cttaaggttttgggtaagagtgtgacgtcactcttgcttgtgtggttgttctagcctcaatgtggacggtcctctgagctcc 40518748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 40579349 - 40579276
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    ||||||||||| | ||||| ||||||||||| ||| |||||  ||||||  ||||||| ||||||||| |||||    
40579349 ccattgccttaggattttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggac 40579276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 1013951 - 1013879
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    |||||||||||  |||||| ||||||||||| ||| ||| | |||||||  ||||||| ||||||||| ||||    
1013951 ccattgccttagagttttgagtaagagtgtgttgtctcttttacttgtgcggttgttctagcctcgatgtgga 1013879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 6e-16; HSPs: 21)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 2 - 73
Target Start/End: Complemental strand, 10074442 - 10074371
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    |||||||||||||||||| ||||||||||| ||| ||||||||| |||| ||||||| ||||||||| ||||    
10074442 cattgccttaaggttttgggtaagagtgtggtgtctctctcactagtgtggttgttctagcctcgatgtgga 10074371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 12085114 - 12085047
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||| |||||||||||||| |||||||||||  || |||||||||||||| ||||||| |||||||||    
12085114 ccatggccttaaggttttgggtaagagtgtggcgtctctctcacttgtgtggttgttctagcctcgat 12085047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 10911645 - 10911719
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||| ||||||  |||||||||||||| ||||| |||  ||| ||||||||||||||||| |||||||    
10911645 cattgccttaaagttttgaataagagtgtgatgtctctcttactaatgttgttgttcaagcctcgatgtggacgg 10911719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 12071765 - 12071704
Alignment:
7 ccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||| |||||||||||  || |||||||||||||| ||||||| |||||||||    
12071765 ccttaaggttttgggtaagagtgtggcgtctctctcacttgtgtggttgttctagcctcgat 12071704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 29518581 - 29518656
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||| ||||||||||||| ||||||||||| ||| |||||  ||||||  ||||||| ||||||||| |||||||    
29518581 ccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacgg 29518656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 29518998 - 29519073
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||| ||||||||||||| ||||||||||| ||| |||||  ||||||  ||||||| ||||||||| |||||||    
29518998 ccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacgg 29519073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 32741257 - 32741332
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||| ||||||||||||| ||||||||||| ||| |||||  ||||||  ||||||| ||||||||| |||||||    
32741257 ccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacgg 32741332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 2843634 - 2843708
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||||||| ||||||||||| | | |||||  |||| || ||||||| ||||||||| |||||||    
2843634 cattgccttaaggttttgggtaagagtgtggtatctctcttgcttgagtggttgttctagcctcgatgtggacgg 2843708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 68
Target Start/End: Original strand, 3409338 - 3409404
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||||||||||||||||| ||||||||||| ||| |||||  ||||||  ||||||| |||||||||    
3409338 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgat 3409404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 76
Target Start/End: Complemental strand, 10073695 - 10073621
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||| |||||| ||||| ||||||||||| ||| ||||||||| |||| ||||||| ||| ||||| |||||||    
10073695 cattggcttaagattttgggtaagagtgtggtgtctctctcactagtgtggttgttctagcatcgatgtggacgg 10073621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 5 - 66
Target Start/End: Complemental strand, 1950261 - 1950200
Alignment:
5 tgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcg 66  Q
    ||||||||||||||| |||||||||||| || ||||| |||||||  ||||||| |||||||    
1950261 tgccttaaggttttgagtaagagtgtgacgtctctcttacttgtgcggttgttctagcctcg 1950200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 76
Target Start/End: Original strand, 16454987 - 16455060
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||| |||||||||||  || |||||  ||||||  ||||||| ||||||||| |||||||    
16454987 attgccttaaggttttgggtaagagtgtggcgtctctcttgcttgtgcggttgttctagcctcgatgtggacgg 16455060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 1846826 - 1846901
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||||||||  |||||||||| ||| ||| |  ||||||  ||||||| ||||||||| |||||||    
1846826 ccattgccttaaggttttggataagagtgtggtgtctcttttgcttgtgcggttgttctagcctcgatgtggacgg 1846901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 2578523 - 2578448
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||| |||||||||||||| ||||||||||| ||| ||| |  ||||||  ||||||| ||||||||| |||||||    
2578523 ccatagccttaaggttttgggtaagagtgtggtgtctcttttgcttgtgcggttgttctagcctcgatgtggacgg 2578448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 10074071 - 10073996
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||| |||| |||||| ||| |||||| ||| | | ||||||| ||||||||  |||||||    
10074071 ccattgccttaaggttttgggtaaaagtgtggtgtctctctcgcttatttggttgttctagcctcgacgtggacgg 10073996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 2 - 49
Target Start/End: Complemental strand, 12092561 - 12092514
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtg 49  Q
    |||||||||||||||||| |||||| |||| ||| |||||||||||||    
12092561 cattgccttaaggttttgagtaagactgtggtgtctctctcacttgtg 12092514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 16107756 - 16107823
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||||||||| ||||||||||| ||| |||||  ||||||  |||| || |||||||||    
16107756 ccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgctctagcctcgat 16107823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 35210282 - 35210357
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||| ||||||||||| ||| ||| |  ||||||  |||| || ||||||||| |||||||    
35210282 ccattgccttaaggttttgggtaagagtgtggtgtttcttttgcttgtgcggttgctctagcctcgatgtggacgg 35210357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 76
Target Start/End: Complemental strand, 14748417 - 14748347
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||| ||||||||||| |||||||||||    ||||||  ||||||| ||||||| ||||||||| |||||||    
14748417 cattgcgttaaggttttgggtaagagtgtg----gtctcttgcttgtgtggttgttctagcctcgatgtggacgg 14748347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 2377832 - 2377904
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    ||||||||||||||||||| ||||||||||| ||| | |||  |||| || ||| ||| ||||||||| ||||    
2377832 ccattgccttaaggttttgggtaagagtgtggtgtctttcttgcttgagtggtttttctagcctcgatgtgga 2377904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 3058304 - 3058344
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctct 41  Q
    ||||||||||||||||||| ||||||||||| ||| |||||    
3058304 ccattgccttaaggttttgggtaagagtgtggtgtctctct 3058344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 29)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 3 - 76
Target Start/End: Original strand, 6421811 - 6421884
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||| ||||||||||| ||| ||||| |||||||| |||||||  |||||||| |||||||    
6421811 attgccttaaggttttgggtaagagtgtggtgtctctctaacttgtgtggttgttctggcctcgatgtggacgg 6421884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 7 - 77
Target Start/End: Original strand, 7598685 - 7598755
Alignment:
7 ccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacggc 77  Q
    |||||| |||||  ||||||||||| ||| |||||||||||||| ||||||||||| ||||| ||||||||    
7598685 ccttaacgtttttggtaagagtgtggtgtctctctcacttgtgtggttgttcaagcatcgatgtggacggc 7598755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 36178685 - 36178611
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacg 75  Q
    ||||||||||||||||||| ||||||||||| ||| |||||  ||||||| ||||||| |||||| || ||||||    
36178685 ccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttctagcctctatgtggacg 36178611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 55
Target Start/End: Complemental strand, 29873616 - 29873563
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttg 55  Q
    |||||||||||||||||| |||||||||||| || |||||||||||||| ||||    
29873616 cattgccttaaggttttgagtaagagtgtgacgtctctctcacttgtgtggttg 29873563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 962676 - 962751
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||| |||||||||||| ||||||||||| |||  ||||  ||||||| ||||||| ||||||||| |||||||    
962676 ccattgtcttaaggttttgggtaagagtgtgttgtcactcttgcttgtgtggttgttctagcctcgatgtggacgg 962751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 3672779 - 3672854
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||| ||||| ||||||||||| ||| ||||| | |||||| ||||||| || |||||| |||||||    
3672779 ccattgccttaagattttgggtaagagtgtggtgtctctcttaattgtgtggttgttctagtctcgatgtggacgg 3672854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 3673147 - 3673221
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||| ||||| |||||  |||||||||||||| ||||| ||| |||| ||||||| ||||||||| |||||||    
3673147 cattgctttaagattttggctaagagtgtgatgtctctcttactagtgtggttgttctagcctcgatgtggacgg 3673221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 7598311 - 7598373
Alignment:
6 gccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||||||||||||| |||||| | || ||| |||||||||||||  |||||||||||||||||    
7598311 gccttaaggttttgggtaagaatatggtgtctctctcacttgtgcggttgttcaagcctcgat 7598373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 6 - 76
Target Start/End: Original strand, 40733965 - 40734035
Alignment:
6 gccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||| |||||| ||||||||||| ||| | |||| ||||||| |||||||||| |||||| |||||||    
40733965 gccttaaagttttgggtaagagtgtggtgtctgtctcgcttgtgtggttgttcaagtctcgatgtggacgg 40734035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 76
Target Start/End: Complemental strand, 5542703 - 5542630
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||  ||||||||||| ||| |||||  ||||||  |||||||||| |||||| |||||||    
5542703 attgccttaaggtttttggtaagagtgtggtgtctctcttgcttgtgcggttgttcaagtctcgatgtggacgg 5542630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 76
Target Start/End: Complemental strand, 5543076 - 5543003
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||| ||||| ||||||||||| ||| ||| |  ||||||  ||||||||||||||||| |||||||    
5543076 attgccttaagattttgggtaagagtgtggtgtctctattgcttgtgcggttgttcaagcctcgatgtggacgg 5543003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 11 - 76
Target Start/End: Original strand, 6421714 - 6421779
Alignment:
11 aaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||| ||||||||||| ||| ||||| |||||||| |||||||  |||||||| |||||||    
6421714 aaggttttgggtaagagtgtggtgtctctctaacttgtgtggttgttccggcctcgatgtggacgg 6421779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 6422188 - 6422261
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    |||| |||||||||||||  ||||||||||| ||| |||||  ||||||| ||||||| ||||||||| |||||    
6422188 ccatagccttaaggttttaggtaagagtgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtggac 6422261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 23346314 - 23346389
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||| |||||||||||||  ||||||||||||||| |||||  ||||||  ||||||| ||||| ||| |||||||    
23346314 ccatagccttaaggttttcggtaagagtgtgatgtctctcttgcttgtgcggttgttctagcctagatgtggacgg 23346389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 37106266 - 37106341
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||| ||||||||||||| ||||||||||| ||| |||||  ||||||   |||||| ||||||||| |||||||    
37106266 ccatttccttaaggttttgggtaagagtgtggtgtttctcttgcttgtgcgattgttctagcctcgatgtggacgg 37106341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 42514727 - 42514802
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||| |||||||| ||||| |||||||||||  || ||||| |||||||  ||||||| ||||||||| |||||||    
42514727 ccatcgccttaagattttgggtaagagtgtggcgtctctcttacttgtggggttgttctagcctcgatgtggacgg 42514802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 6421464 - 6421538
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||| |||||||| ||||||||||| ||| |||||  ||||||  ||||||| || |||||| |||||||    
6421464 cattgccttgaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagtctcgatgtggacgg 6421538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 15511575 - 15511501
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacg 75  Q
    |||||| |||||| ||||| ||||||||||| ||| |||||  ||||||| ||||||| || |||||| ||||||    
15511575 ccattgtcttaagattttgggtaagagtgtggtgtctctcttgcttgtgtggttgttctagtctcgatgtggacg 15511501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 15880341 - 15880415
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacg 75  Q
    ||||||||||||||||||| |||||||||||  || |||||  ||||||  ||||||  ||||||||| ||||||    
15880341 ccattgccttaaggttttgggtaagagtgtggcgtctctcttgcttgtgcggttgttttagcctcgatgtggacg 15880415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 37106003 - 37106077
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||| ||||| ||||||||||| ||| |||||  |||||   ||||||| ||||||||| |||||||    
37106003 cattgccttaagattttgggtaagagtgtggtgtctctcttgcttgtacggttgttctagcctcgatgtggacgg 37106077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 7 - 73
Target Start/End: Original strand, 40733601 - 40733667
Alignment:
7 ccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    |||||| |||||| ||||||||||| ||| |||||| ||||||| || ||||||| |||||| ||||    
40733601 ccttaaagttttgggtaagagtgtggtgtctctctcgcttgtgtggtagttcaagtctcgatgtgga 40733667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 14745747 - 14745674
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    ||||||||||||||||||| |||||||||||  || |||||  |  |||| ||||||| ||||||||| |||||    
14745747 ccattgccttaaggttttgggtaagagtgtggcgtctctcttgcaagtgtggttgttctagcctcgatgtggac 14745674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 28254316 - 28254262
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttc 58  Q
    |||||||||||||||||| |||||||||||  ||||||||| ||||||  |||||||    
28254316 cattgccttaaggttttgggtaagagtgtg--gtgtctctctcttgtggggttgttc 28254262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 55
Target Start/End: Original strand, 30313256 - 30313309
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttg 55  Q
    |||||||||||| ||||| |||||||||||  || |||||||||||||| ||||    
30313256 cattgccttaagattttgggtaagagtgtggcgtctctctcacttgtgtggttg 30313309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 34
Target Start/End: Complemental strand, 31468829 - 31468797
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatg 34  Q
    |||||||||||||||||| ||||||||||||||    
31468829 cattgccttaaggttttgggtaagagtgtgatg 31468797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 33561530 - 33561486
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcactt 46  Q
    ||||| |||||||||||| ||||||||||||| | ||||||||||    
33561530 cattgtcttaaggttttgggtaagagtgtgatatctctctcactt 33561486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 74
Target Start/End: Complemental strand, 36005959 - 36005887
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    |||||||||||||||||| |||| ||||||  || |||||  ||||||  ||||||| ||||||||| |||||    
36005959 cattgccttaaggttttgggtaaaagtgtggcgtctctcttgcttgtggggttgttctagcctcgatgtggac 36005887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 9 - 77
Target Start/End: Complemental strand, 37632669 - 37632601
Alignment:
9 ttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacggc 77  Q
    ||||||||||| ||||||||||| ||| ||||| ||  ||||  |||||| ||||||||| ||||||||    
37632669 ttaaggttttgggtaagagtgtggtgtatctcttacaagtgtgattgttctagcctcgatgtggacggc 37632601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 41678445 - 41678401
Alignment:
4 ttgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgt 48  Q
    |||||||||||||||| |||||||||| | || ||||||||||||    
41678445 ttgccttaaggttttgagtaagagtgtaacgtctctctcacttgt 41678401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 22)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 38427625 - 38427697
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    |||||| ||||||||||||||||||||||||| || |||||||||||||  ||||||| | ||||||| ||||    
38427625 ccattgtcttaaggttttgtgtaagagtgtgacgtctctctcacttgtgcggttgttctaacctcgatgtgga 38427697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 624274 - 624349
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||| ||||| |||||||| ||||||||||| ||| |||||||||||||  ||||||| ||||||||| |||||||    
624274 ccatagccttgaggttttgggtaagagtgtggtgtctctctcacttgtggggttgttctagcctcgatgtggacgg 624349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 6500528 - 6500603
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||| ||||||||||| ||| |||||  ||||||  ||||||| ||||||||| |||||||    
6500528 ccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacgg 6500603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 76
Target Start/End: Complemental strand, 3295422 - 3295350
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||| ||||||||||| ||| |||||  ||||||| ||||||| ||||||||| |||||||    
3295422 attgccttaaggttttg-gtaagagtgtgttgtctctcttgcttgtgtggttgttctagcctcgatgtggacgg 3295350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 32487471 - 32487543
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    ||||||||||||||||||| |||||||||||| || |||||  ||| ||| ||||||| ||||||||| ||||    
32487471 ccattgccttaaggttttgggtaagagtgtgacgtatctcttgcttatgtggttgttctagcctcgatgtgga 32487543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 6 - 65
Target Start/End: Original strand, 623901 - 623960
Alignment:
6 gccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctc 65  Q
    |||||||||||||| ||||||||||| ||| |||||||||||||  ||||||| ||||||    
623901 gccttaaggttttgagtaagagtgtggtgtctctctcacttgtggggttgttctagcctc 623960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 26074226 - 26074159
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||||||||| ||||||||||| ||| ||||||||| |||| |||| || | |||||||    
26074226 ccattgccttaaggttttgggtaagagtgtggtgtctctctcactagtgtggttgctctaacctcgat 26074159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 26074690 - 26074757
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||||||||| ||||||||||| ||| ||||||||| |||| |||| || | |||||||    
26074690 ccattgccttaaggttttgggtaagagtgtggtgtctctctcactagtgtggttgctctaacctcgat 26074757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 40296395 - 40296320
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||| |||||||| ||||||||||| ||| |||||  ||||||  ||||||| ||||||||| |||||||    
40296395 ccattgccttgaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacgg 40296320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 6500901 - 6500975
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||  |||||||||| ||| ||||| |||||||  ||| ||| ||||||||| |||||||    
6500901 cattgccttaaggttttggataagagtgtggtgtctctcttacttgtgcggttattctagcctcgatgtggacgg 6500975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 7 - 76
Target Start/End: Complemental strand, 1028591 - 1028522
Alignment:
7 ccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||  |||||||||||  || |||||||||||||  ||||||| ||||||||| |||||||    
1028591 ccttaaggtttttggtaagagtgtggcgtctctctcacttgtgcggttgttctagcctcgatgtggacgg 1028522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 76
Target Start/End: Complemental strand, 34753103 - 34753030
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||| |||||||||||  || |||||  ||||||  ||||||| ||||||||| |||||||    
34753103 attgccttaaggttttgggtaagagtgtggcgtctctcttgcttgtgcggttgttctagcctcgatgtggacgg 34753030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 41170712 - 41170777
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcg 66  Q
    ||||||||||||||||||| ||||||||||| ||| | |||  ||||||| ||||||| |||||||    
41170712 ccattgccttaaggttttgggtaagagtgtggtgtttttcttgcttgtgtggttgttctagcctcg 41170777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 11417057 - 11417025
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgat 33  Q
    |||||||||||||||||||||||||||||||||    
11417057 ccattgccttaaggttttgtgtaagagtgtgat 11417025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 18603200 - 18603120
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacggctctc 81  Q
    ||||||||||||||||||| |||||||||||   | |||||  ||||||| || |||| ||||||||| ||||||| ||||    
18603200 ccattgccttaaggttttgggtaagagtgtggcatctctcttgcttgtgtggtagttctagcctcgatgtggacggttctc 18603120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 26590986 - 26590918
Alignment:
5 tgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    ||||||||||||||| |||||||||||  || ||||||||| |||| ||||||| | ||||||| ||||    
26590986 tgccttaaggttttgagtaagagtgtggcgtctctctcactagtgtggttgttctaacctcgatgtgga 26590918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 76
Target Start/End: Complemental strand, 42405672 - 42405603
Alignment:
5 tgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||| |||||||||||  ||||||||  ||||||  ||||||| ||||||||| |||||||    
42405672 tgccttaaggttttgggtaagagtgtg--gtgtctcttgcttgtgcggttgttctagcctcgatgtggacgg 42405603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 6 - 76
Target Start/End: Original strand, 15370182 - 15370252
Alignment:
6 gccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||| ||||||||||| ||| |||||  ||||||   |||||| ||||||||| |||||||    
15370182 gccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgggattgttctagcctcgatgtggacgg 15370252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 35150084 - 35150141
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttc 58  Q
    |||||| |||||||||||| |||| |||||| ||| ||||||||| |||| |||||||    
35150084 ccattgtcttaaggttttgggtaaaagtgtggtgtctctctcactagtgtggttgttc 35150141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 36522310 - 36522269
Alignment:
8 cttaaggttttgtgtaagagtgtgatgtgtctctcacttgtg 49  Q
    |||||||||||| ||||||||||| ||| |||||||||||||    
36522310 cttaaggttttgggtaagagtgtggtgtctctctcacttgtg 36522269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 36568647 - 36568577
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    ||||||||||||||||||  |||||||||||  | ||||||| ||||||| ||||||| | ||||||| ||||    
36568647 ccattgccttaaggtttttggtaagagtgtg--gcgtctctctcttgtgtggttgttctatcctcgatgtgga 36568577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 50
Target Start/End: Complemental strand, 36527174 - 36527126
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgt 50  Q
    |||||||||||| |||||  |||||||||| ||| ||||||||||||||    
36527174 cattgccttaagattttggataagagtgtgctgtctctctcacttgtgt 36527126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 28)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 39935035 - 39934963
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    |||||||||||| |||||| ||||||||||||||| |||||  ||||||| ||||||| ||||||||| ||||    
39935035 ccattgccttaaagttttgagtaagagtgtgatgtctctcttgcttgtgtggttgttctagcctcgatgtgga 39934963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 32589781 - 32589856
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||| ||||||||| ||||| |||||  ||||||| ||||||| || |||||| |||||||    
32589781 ccattgccttaaggttttgggtaagagtgcgatgtctctcttgcttgtgtggttgttctaggctcgatgtggacgg 32589856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 2 - 76
Target Start/End: Complemental strand, 37990718 - 37990644
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||||||| ||||||||||| ||| |||||  |||||||  |||||| ||||||||| |||||||    
37990718 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtgattgttctagcctcgatgtggacgg 37990644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 22303739 - 22303672
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||||||||| ||||||||||| ||| ||||| |||||||   |||||| |||||||||    
22303739 ccattgccttaaggttttgggtaagagtgtggtgtttctcttacttgtgcgattgttctagcctcgat 22303672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 32462980 - 32462913
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||||||||| ||||||||||| ||| |||||  ||||||  ||||||| |||||||||    
32462980 ccattgccttaaggttttgagtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgat 32462913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 41359845 - 41359778
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    ||||||||||||||||||| |||||| ||||  || |||||| ||||||| ||||||| |||||||||    
41359845 ccattgccttaaggttttgggtaagaatgtggcgtctctctcgcttgtgtggttgttctagcctcgat 41359778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 2 - 89
Target Start/End: Complemental strand, 42342169 - 42342082
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacggctctctgaactcc 89  Q
    |||||||||||||||||| |||||||||||  || |||||  ||||||  ||||||| ||||||||| |||||||  ||| |||||||    
42342169 cattgccttaaggttttgggtaagagtgtggcgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcctccgaactcc 42342082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 6 - 76
Target Start/End: Complemental strand, 37991052 - 37990982
Alignment:
6 gccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||| ||||||||||| ||| |||||  ||| ||| ||||||| ||||||||| |||||||    
37991052 gccttaaggttttgggtaagagtgtggtgtctctcttgcttatgtggttgttctagcctcgatgtggacgg 37990982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 76
Target Start/End: Complemental strand, 43346870 - 43346796
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||||||| ||||||||||| ||| |||||  ||||||  ||||||| |||||| || |||||||    
43346870 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctctatgtggacgg 43346796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 46546405 - 46546371
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgt 35  Q
    |||||||||||||||||||||||||||||||||||    
46546405 ccattgccttaaggttttgtgtaagagtgtgatgt 46546371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 54017891 - 54017829
Alignment:
6 gccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||||||||||||| ||||||||||| ||| ||||| |||||||| ||||||| ||| |||||    
54017891 gccttaaggttttgggtaagagtgtggtgtctctcttacttgtgtggttgttctagcttcgat 54017829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 22304035 - 22303963
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    |||||||||||||||||||  |||||||||| ||| |||||  |||| || ||||||| ||||||||| ||||    
22304035 ccattgccttaaggttttggataagagtgtggtgtctctcttgcttgagtggttgttctagcctcgatgtgga 22303963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 74
Target Start/End: Original strand, 22304648 - 22304720
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    |||||||||||||||||| ||||||||||| ||| |||||  ||||||  ||||||| || |||||| |||||    
22304648 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagtctcgatgtggac 22304720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 50
Target Start/End: Complemental strand, 39336049 - 39336001
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgt 50  Q
    |||||||||||||||||| ||||||||||| ||| |||||| |||||||    
39336049 cattgccttaaggttttgggtaagagtgtggtgtctctctcgcttgtgt 39336001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 45395733 - 45395661
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    |||||| ||||| |||||| ||||||||||| ||| |||||||||||||  |||| || ||||||||| ||||    
45395733 ccattgtcttaatgttttgggtaagagtgtggtgtctctctcacttgtggggttgctctagcctcgatgtgga 45395661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 3 - 55
Target Start/End: Complemental strand, 47964596 - 47964544
Alignment:
3 attgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttg 55  Q
    ||||||||||||||||| |||||||||||  || |||||||||||||| ||||    
47964596 attgccttaaggttttgggtaagagtgtggcgtctctctcacttgtgtggttg 47964544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 12114642 - 12114575
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||||| |||||||||||| ||||||||||| ||| ||||| |||||||  ||||||| |||| ||||    
12114642 ccattgtcttaaggttttgggtaagagtgtggtgtctctcttacttgtgcggttgttctagccacgat 12114575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 4 - 55
Target Start/End: Original strand, 25317239 - 25317290
Alignment:
4 ttgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttg 55  Q
    |||||||||||||||| |||| |||||  |||||||||||||||||| ||||    
25317239 ttgccttaaggttttgggtaaaagtgtagtgtgtctctcacttgtgtggttg 25317290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 33803332 - 33803257
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||| ||||||| ||| |||||||||||  || || ||| ||||||| ||||||| ||||||||| |||||||    
33803332 ccattgcattaaggtattgggtaagagtgtggcgtctccctctcttgtgtggttgttctagcctcgatgtggacgg 33803257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 37726574 - 37726649
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||| ||||||||  ||||||||||| || | ||| |||||| | ||||||| ||||||||| |||||||    
37726574 ccattgcctttaggttttggataagagtgtgacgtttatcttacttgtatagttgttctagcctcgatgtggacgg 37726649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 42342468 - 42342393
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||| |||||||||||| |||||||||||| || |||||  ||||||  ||||||| |||||| || |||||||    
42342468 ccattgtcttaaggttttgggtaagagtgtgacgtctctcttgcttgtgcggttgttctagcctcaatgtggacgg 42342393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 52634753 - 52634816
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcct 64  Q
    ||||||||||||||||||| |||||||||||| || |||||  ||||||  ||||||| |||||    
52634753 ccattgccttaaggttttgggtaagagtgtgacgtctctcttgcttgtgcagttgttctagcct 52634816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 15772933 - 15773007
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||| |||||||||||  |||||||||| ||| |||||  ||||||| ||||||| | ||||||| |||||||    
15772933 cattgctttaaggttttggataagagtgtggtgtctctcttgcttgtgtggttgttctaacctcgatgtggacgg 15773007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 31190087 - 31190161
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacg 75  Q
    |||| |||||||||||||| ||||||||||| ||| |||||  |||||   ||||||| ||||||||| ||||||    
31190087 ccatagccttaaggttttgggtaagagtgtggtgtctctcttgcttgtcgggttgttctagcctcgatttggacg 31190161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 54018273 - 54018211
Alignment:
6 gccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgat 68  Q
    |||||||||||||| ||||||||||| ||| ||||   ||||||| ||||||| |||||||||    
54018273 gccttaaggttttgggtaagagtgtggtgtctctcatgcttgtgtggttgttctagcctcgat 54018211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 75
Target Start/End: Original strand, 15773271 - 15773346
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtct--ctcacttgtgtcgttgttcaagcctcgatatggacg 75  Q
    ||||||||||| |||||| ||||||||||||||| |||  ||  ||||||| ||||||| | ||||||| ||||||    
15773271 cattgccttaaagttttgggtaagagtgtgatgtctcttgcttgcttgtgtggttgttctaacctcgatgtggacg 15773346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 4 - 76
Target Start/End: Original strand, 35946603 - 35946675
Alignment:
4 ttgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||||||| |||| |||||| ||| |||||  ||||||   |||||| ||||||||| |||||||    
35946603 ttgccttaaggttttgggtaaaagtgtggtgtctctcttgcttgtgcaattgttctagcctcgatgtggacgg 35946675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 76
Target Start/End: Complemental strand, 50612520 - 50612452
Alignment:
8 cttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    |||||||||||| ||||||||||||||| |||||  |||| || ||||||| | ||||||  |||||||    
50612520 cttaaggttttgggtaagagtgtgatgtctctcttgcttgagtggttgttccatcctcgacgtggacgg 50612452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0391 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0391
Description:

Target: scaffold0391; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 1186 - 1111
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggacgg 76  Q
    ||||||||||||||||||| |||||||| || ||| |||||   || ||| ||||||| ||||||||| |||||||    
1186 ccattgccttaaggttttgggtaagagtatggtgtctctcttgtttatgtggttgttctagcctcgatgtggacgg 1111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0702 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0702
Description:

Target: scaffold0702; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 594 - 522
Alignment:
1 ccattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatgga 73  Q
    ||||||||||||||||||| ||||||||||| ||| | |||  |||| || ||| ||| ||||||||| ||||    
594 ccattgccttaaggttttgggtaagagtgtggtgtctttcttgcttgagtggtttttctagcctcgatgtgga 522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0078
Description:

Target: scaffold0078; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 74
Target Start/End: Original strand, 5061 - 5133
Alignment:
2 cattgccttaaggttttgtgtaagagtgtgatgtgtctctcacttgtgtcgttgttcaagcctcgatatggac 74  Q
    |||||||||| ||||||| ||||||||||| ||| |||||| ||| ||  |||| || ||||||||| |||||    
5061 cattgccttatggttttgggtaagagtgtggtgtctctctcgcttatgcggttgctctagcctcgatgtggac 5133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University