View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3875_high_8 (Length: 335)

Name: NF3875_high_8
Description: NF3875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3875_high_8
NF3875_high_8
[»] chr2 (2 HSPs)
chr2 (3-211)||(26272529-26272735)
chr2 (274-322)||(26272798-26272846)
[»] chr8 (2 HSPs)
chr8 (3-184)||(43712153-43712332)
chr8 (274-322)||(43712015-43712063)
[»] chr1 (1 HSPs)
chr1 (1-56)||(27196436-27196491)


Alignment Details
Target: chr2 (Bit Score: 67; Significance: 1e-29; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 3 - 211
Target Start/End: Original strand, 26272529 - 26272735
Alignment:
3 atgaaggagctttttgatactggttttcttgatggtgttcctgttgtttatgtcatgttgtttacgttgtttaannnnnnnnnncgtggcctctccttca 102  Q
    ||||||||||||||| |||||| ||||||||||||||||| ||||||||||||| |||||||||||| |||||           |  ||| | |||||||    
26272529 atgaaggagcttttttatactgattttcttgatggtgttcttgttgtttatgtcctgttgtttacgtcgttta--tttttttccctgggcttttccttca 26272626  T
103 gatcccgttttgggttgtttttcttgttcctacggcggcagagagttggtcagtggtggcgccgctgttgattggtggcagcaaaatcactgttgtttcg 202  Q
    |||||| |||||||||||||||||||||||||||||||| | ||||| ||  ||||| | || || |||| |||||||||||  | |||||| | ||||     
26272627 gatcccattttgggttgtttttcttgttcctacggcggcggggagttcgttggtggtagtgctgccgttgtttggtggcagcgcagtcactgctatttca 26272726  T
203 tcggagtcg 211  Q
    |||||||||    
26272727 tcggagtcg 26272735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 274 - 322
Target Start/End: Original strand, 26272798 - 26272846
Alignment:
274 ggataagagaccattatttccatggcttctcgttgagcatctgttcttc 322  Q
    ||||| ||||||||||||||||| ||||||| |||| | ||||||||||    
26272798 ggatacgagaccattatttccatagcttctcattgaccctctgttcttc 26272846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 3 - 184
Target Start/End: Complemental strand, 43712332 - 43712153
Alignment:
3 atgaaggagctttttgatactggttttcttgatggtgttcctgttgtttatgtcatgttgtttacgttgtttaannnnnnnnnncgtggcctc-tccttc 101  Q
    ||||||| |||| || |||||| ||||||||||||||||| ||||||||||||| |||||||||||| ||||||          | ||| ||| ||||||    
43712332 atgaaggtgcttatttatactgattttcttgatggtgttcttgttgtttatgtcctgttgtttacgtcgtttaa---ttttttccctgggctcttccttc 43712236  T
102 agatcccgttttgggttgtttttcttgttcctacggcggcagagagttggtcagtggtggcgccgctgttgattggtggcagc 184  Q
    | ||||| ||||||||||||||||||| |||||||||||| | ||||| ||| ||||| | ||||| |||| |||||||||||    
43712235 atatcccattttgggttgtttttcttgctcctacggcggcggggagttagtcggtggtagtgccgccgttgtttggtggcagc 43712153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 274 - 322
Target Start/End: Complemental strand, 43712063 - 43712015
Alignment:
274 ggataagagaccattatttccatggcttctcgttgagcatctgttcttc 322  Q
    ||||| |||||||||| ||||||||||||||||||| | ||||||||||    
43712063 ggatatgagaccattaattccatggcttctcgttgaccctctgttcttc 43712015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 27196436 - 27196491
Alignment:
1 ctatgaaggagctttttgatactggttttcttgatggtgttcctgttgtttatgtc 56  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
27196436 ctatgaaggagctttttgatactggttttcttgatggtgttccggttgtttatgtc 27196491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University