View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3876_low_14 (Length: 250)
Name: NF3876_low_14
Description: NF3876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3876_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 49764510 - 49764274
Alignment:
| Q |
1 |
ccctagtagcagtgtgcttttcgagagtcagagtagtaggtagtgaatataggtcatctcctctttgggagcgtaggtttggtatttacnnnnnnnttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49764510 |
ccctagtagcagtgtgcttttcgagagtcagagtagtaggtagtgaatataggtcatctcctctttgggagcgtaggtttggtatttatgggggggttac |
49764411 |
T |
 |
| Q |
101 |
cctagaggaaagcggaactgctccagttcacgtcttcccacgacgaccctttcttctcgccctctccccctaactataggcacattgtgcataggtgggg |
200 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49764410 |
cctagaggaaagcggaactactccaattcacgtcttcccacgacgaccctttcttctcgccctctccccctgactataggcacattgtgcataggtgggg |
49764311 |
T |
 |
| Q |
201 |
aagactgagtcagggctgacttggatcccttagacct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49764310 |
aagactgagtcagggctgacttggatcccttagacct |
49764274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 57
Target Start/End: Complemental strand, 21272526 - 21272482
Alignment:
| Q |
13 |
tgtgcttttcgagagtcagagtagtaggtagtgaatataggtcat |
57 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
21272526 |
tgtgctttttcagagtcagagtaataggttgtgaatataggtcat |
21272482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University