View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3877_high_2 (Length: 328)

Name: NF3877_high_2
Description: NF3877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3877_high_2
NF3877_high_2
[»] chr2 (3 HSPs)
chr2 (223-312)||(12138272-12138361)
chr2 (25-97)||(12139683-12139755)
chr2 (151-231)||(12138392-12138472)


Alignment Details
Target: chr2 (Bit Score: 86; Significance: 4e-41; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 223 - 312
Target Start/End: Complemental strand, 12138361 - 12138272
Alignment:
Q  223 gattattatcccgttaattgtcgaacctaaggaagttaactatcacttccagataaaaatgcaatttcaaggaagaacacgggcaaaagg 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  12138361 gattattatcccgttaattgtcgaacctaaggaagttaactatcacttctagataaaaatgcaatttcaaggaagaacacgggcaaaagg 12138272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 25 - 97
Target Start/End: Complemental strand, 12139755 - 12139683
Alignment:
Q  25 caatgtgtggaaaattttgtttagacagcctaaattgctctcaaacgaaactacacataataatggggactaa 97  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  12139755 caatgtgtggaaaattttgtttagacagcctaatttgctctcaaacgaaactacacataataatggggactaa 12139683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 151 - 231
Target Start/End: Complemental strand, 12138472 - 12138392
Alignment:
Q  151 catagtgatggataaatatgacaatattaatgaattgttttaatattaaccaccatttttgacatatagaaggattattat 231  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | ||||||||||| ||||||    
T  12138472 catattgatggataaatatgacaatattaatgaattgttttaatattaacgaccattttttatatatagaaggactattat 12138392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University