View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3877_low_2 (Length: 328)
Name: NF3877_low_2
Description: NF3877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3877_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 4e-41; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 223 - 312
Target Start/End: Complemental strand, 12138361 - 12138272
Alignment:
| Q |
223 |
gattattatcccgttaattgtcgaacctaaggaagttaactatcacttccagataaaaatgcaatttcaaggaagaacacgggcaaaagg |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12138361 |
gattattatcccgttaattgtcgaacctaaggaagttaactatcacttctagataaaaatgcaatttcaaggaagaacacgggcaaaagg |
12138272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 25 - 97
Target Start/End: Complemental strand, 12139755 - 12139683
Alignment:
| Q |
25 |
caatgtgtggaaaattttgtttagacagcctaaattgctctcaaacgaaactacacataataatggggactaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12139755 |
caatgtgtggaaaattttgtttagacagcctaatttgctctcaaacgaaactacacataataatggggactaa |
12139683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 151 - 231
Target Start/End: Complemental strand, 12138472 - 12138392
Alignment:
| Q |
151 |
catagtgatggataaatatgacaatattaatgaattgttttaatattaaccaccatttttgacatatagaaggattattat |
231 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | ||||||||||| |||||| |
|
|
| T |
12138472 |
catattgatggataaatatgacaatattaatgaattgttttaatattaacgaccattttttatatatagaaggactattat |
12138392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University