View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3878_high_12 (Length: 364)
Name: NF3878_high_12
Description: NF3878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3878_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 11 - 350
Target Start/End: Complemental strand, 37170336 - 37169997
Alignment:
| Q |
11 |
gaagcaaaggatgatcaagcattttcagaatctttctctccatttcagctctatgtgatttcttctttaatgcaacaacgtctttatccacaaccttcat |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170336 |
gaagaaaaggatgatcaagcattttcagaatctttctctccatttcagctctatgtgatttcttctttaatgcaacaacgtctttatccacaaccttcat |
37170237 |
T |
|
| Q |
111 |
cgcatacaaacaagtgttatcttcttcgtttttgaatttgtcatttccgtttctcaggcggcataggtaaacagtaccgatatctccggcgccgatacgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170236 |
cgcatacaaacaagtgttatcttcttcgtttttgaatttgtcatttccgtttctcaggcggcataggtaaacagtaccgatatctccggcgccgatacgg |
37170137 |
T |
|
| Q |
211 |
cggaggaggtggaagtcacgaaatgtgagagcggacttgcgacggatggcggagtaagcgaagtcggaggagcggtgaggtttgagggcgagactatccg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
37170136 |
cggaggaggtggaagtcacgaaatgtgagagcggacttgcgacggatggcggagtaagcgaagtcggaggagcggtgaggtttgagggagagactctccg |
37170037 |
T |
|
| Q |
311 |
gtgaaggaggaagaaggtcgaatgagagacggctgaaact |
350 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37170036 |
gtgaaggaggaagaaggtcgaatgaaagacggctgaaact |
37169997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 166 - 347
Target Start/End: Original strand, 6073591 - 6073772
Alignment:
| Q |
166 |
aggcggcataggtaaacagtaccgatatctccggcgccgatacggcggaggaggtggaagtcacgaaatgtgagagcggacttgcgacggatggcggagt |
265 |
Q |
| |
|
||||| || |||||||| || || || || |||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| |||||||||| || |
|
|
| T |
6073591 |
aggcgacagaggtaaacggtgcctatgtcgccggcgcctatacggcggaggagatggaagtcacggaaggtgaggccggatttg---cggatggcggtgt |
6073687 |
T |
|
| Q |
266 |
aagcgaagtcggaggagcggtgaggtttgagggcgagactatccggtga--agga-ggaagaaggtcgaatgagagacggctgaa |
347 |
Q |
| |
|
| |||||||||||||| || |||||||||| || |||| ||||| || |||| ||||| |||||||| |||||||||||||| |
|
|
| T |
6073688 |
aggcgaagtcggaggaacgatgaggtttgatggagagagattccggcgaggaggatggaagtaggtcgaaggagagacggctgaa |
6073772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 11 - 131
Target Start/End: Original strand, 6073436 - 6073556
Alignment:
| Q |
11 |
gaagcaaaggatgatcaagcattttcagaatctttctctccatttcagctctatgtgatttcttctttaatgcaacaacgtctttatccacaaccttcat |
110 |
Q |
| |
|
|||| ||||||||||||||||| || || ||||||||||||||||| |||||||| || || ||||| | |||||| |||| ||||| ||||||||||| |
|
|
| T |
6073436 |
gaagaaaaggatgatcaagcatcttaagtatctttctctccatttccgctctatgagactttttcttaagagcaacagcgtccttatcaacaaccttcat |
6073535 |
T |
|
| Q |
111 |
cgcatacaaacaagtgttatc |
131 |
Q |
| |
|
|| || || |||||||||| |
|
|
| T |
6073536 |
ggcgtagaaggaagtgttatc |
6073556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University