View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3878_high_14 (Length: 341)
Name: NF3878_high_14
Description: NF3878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3878_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 33715660 - 33715613
Alignment:
| Q |
276 |
gtaatgtaatgttgcattgtgttatagatttgacgtgcacgataatag |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33715660 |
gtaatgtaatgttgcattgtgttatagatttgacgtgcacgataatag |
33715613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 129 - 189
Target Start/End: Original strand, 17101654 - 17101715
Alignment:
| Q |
129 |
ggagaaaacttaagtataattttttaggtgtttttcatatggtt-aagaaccatacgaaaag |
189 |
Q |
| |
|
|||||||||||| ||| ||||| ||||||| ||||| ||||||| |||||||||||||||| |
|
|
| T |
17101654 |
ggagaaaacttaggtacaatttcttaggtgcttttcgtatggttctagaaccatacgaaaag |
17101715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 129 - 189
Target Start/End: Complemental strand, 17101745 - 17101684
Alignment:
| Q |
129 |
ggagaaaacttaagtataattttttaggtgtttttcatatggtt-aagaaccatacgaaaag |
189 |
Q |
| |
|
|||||||||||| ||| ||||| ||||||| ||||| ||||||| |||||||||||||||| |
|
|
| T |
17101745 |
ggagaaaacttaggtacaatttcttaggtgcttttcgtatggttctagaaccatacgaaaag |
17101684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 128 - 172
Target Start/End: Complemental strand, 36822932 - 36822888
Alignment:
| Q |
128 |
gggagaaaacttaagtataattttttaggtgtttttcatatggtt |
172 |
Q |
| |
|
||||||||||||| ||| ||||||||||||| ||||| ||||||| |
|
|
| T |
36822932 |
gggagaaaacttaggtacaattttttaggtgcttttcgtatggtt |
36822888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University