View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3878_low_19 (Length: 313)
Name: NF3878_low_19
Description: NF3878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3878_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 215 - 294
Target Start/End: Complemental strand, 43428900 - 43428821
Alignment:
| Q |
215 |
attctcgacttaaatggtgggaattttatttgttcataaacaattttaaatgacaaattgtaggtgtctagttatctagc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43428900 |
attctcgacttaaatggtgggaattttatttgttcataaacaattttaaatgagaaattgtaggtgtctagttatctagc |
43428821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 140 - 214
Target Start/End: Complemental strand, 43429007 - 43428933
Alignment:
| Q |
140 |
cttcgggaggggttttcttgtaggtctggtattaagggtttcccatgcccctgttagtgttgtcatgaatttagt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43429007 |
cttcgggaggggttttcttgtaggtctggtattaagggtttcccatgcccctgttagtgttgtcatgaatttagt |
43428933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University