View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3878_low_20 (Length: 298)
Name: NF3878_low_20
Description: NF3878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3878_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 10 - 254
Target Start/End: Complemental strand, 40929254 - 40929010
Alignment:
| Q |
10 |
ataattcttaaacggttaaatttacctgatttgattcaagttattctccgccatatcaaatccagcgtgagggaaattatagactacgcgatcgaaaatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40929254 |
ataattcttaaacggttaaatttacctgatttgattcaagttattctccgccatatcaaatccagcgtgagggaaattatagactacgcgatcgaaaatt |
40929155 |
T |
 |
| Q |
110 |
ttattttgtaacattggatgcttatggacactatgggcatcaacttcatgtacaatgctgcagccaaatttctctagttcttccaaatttgttgaagctc |
209 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40929154 |
ttattttgtaacattggatgcttgtggacactatgggcatcaacttcatgtacaatgctgcagccaaatttctctagttcttccaaatttgttgaagctc |
40929055 |
T |
 |
| Q |
210 |
ttgaatatttcattatcaatgaccctaataaaacattaagaaaaa |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40929054 |
ttgaatatttcattatcaatgaccctaataaaacattaagaaaaa |
40929010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University