View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3878_low_30 (Length: 234)
Name: NF3878_low_30
Description: NF3878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3878_low_30 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 2 - 234
Target Start/End: Original strand, 39299907 - 39300139
Alignment:
| Q |
2 |
tctctcttgatcttcctcttccaccaatatctcccaaaccttcacctctttctttcatgccttctgcaccttgtctgtgtccaactacatttgtagcatg |
101 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299907 |
tctctctttctcttcctcttccaccaatatctcccaaaccttcacctctttctttcatgccttctgcaccttgtctgtgtccaactacatttgtagcatg |
39300006 |
T |
 |
| Q |
102 |
atgacgatccctctcactctgtttcacattttgatcagagtgagactgaaaaccttgtttgtgtccaaggttggtagcagcagcatgatgatgatcccta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39300007 |
atgacgatccctctcactctgtttcacattttgatcagagtgagactgaaaaccttgcttgtgaccaaggttcgtagcagcagcatgatgatgatcccta |
39300106 |
T |
 |
| Q |
202 |
tcactctgcttcacatttgaaccaagttcatga |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39300107 |
tcactctgcttcacatttgaaccaagttcatga |
39300139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 39300140 - 39300174
Alignment:
| Q |
1 |
gtctctcttgatcttcctcttccaccaatatctcc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300140 |
gtctctcttgatcttcctcttccaccaatatctcc |
39300174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University