View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3879_high_29 (Length: 351)
Name: NF3879_high_29
Description: NF3879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3879_high_29 |
 |  |
|
| [»] scaffold0062 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0062 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 14 - 332
Target Start/End: Original strand, 43530 - 43848
Alignment:
| Q |
14 |
tcatcagttattagaggattcaggttgtttgctacaagtttgattctttcattcaaattttagatgttatcattgggtgtggttctccggttgttgtcta |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43530 |
tcatcagttattggaggattcaggttgtttgctacaagtttgattctttcattcaaattttagatgttatcattgggtgtggttctccggttgttgtcta |
43629 |
T |
 |
| Q |
114 |
ttgtcttttggtgaaaattgtaaaatgtgtatgtattgaggtcctttgagctgcaatggtggcaagtctttggattaacctctcaactgtgcgatttgat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43630 |
ttgtcttttggtgaaaattgtaaaatgtgtatgtattgaggtcctttgagctgcaatggtggcaagtctttggattaacctctcagctgtgcgatttgat |
43729 |
T |
 |
| Q |
214 |
cagtgataatttgctaattcctcatctctgcagataattttttgtaaattagatggcaagtttttgtattagagctcttgctatttcctttactcgtgtt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43730 |
cagtgataatttgctaattcctcatctctgcagataattttttgtaaatttgatggcaagtttgtgtattagagctcttgctatttcctttactcgtgtt |
43829 |
T |
 |
| Q |
314 |
gttaaggatgcattatttc |
332 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
43830 |
gctaaggatgcattatttc |
43848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University