View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3879_high_53 (Length: 255)
Name: NF3879_high_53
Description: NF3879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3879_high_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 21838631 - 21838863
Alignment:
| Q |
1 |
aatatctaggaaatgttgagagataggattgtaaaaatttccatatttttcatcagaactctagctgccaaagaaaatacaaaaccgagtttatgcatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21838631 |
aatatctaggaaatgttgagagataggattgtaaaaatttccatattttttatcagaactctagctgccaaaggaaatacaaaaccgagtttatgcatat |
21838730 |
T |
 |
| Q |
101 |
ttgattttaaccgttcaatttcaaattaacagtcgaaatcgtgtagcaacatgatttttcttacaagtgaaaccccggtttaccctgcattattgctctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21838731 |
ttgattttaaccgttcaatttcaaattaacagtcgaaatcgtgtaacagcatgatttttcttacaagtgaaaccccggtttaccctgcattattgttctt |
21838830 |
T |
 |
| Q |
201 |
agagtctgctcaaatgcacttatacctactgac |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21838831 |
agagtctgctcaaatgcacttatacctactgac |
21838863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University