View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3879_high_59 (Length: 240)
Name: NF3879_high_59
Description: NF3879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3879_high_59 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 39539068 - 39538848
Alignment:
| Q |
18 |
gttcgaccatgaggatccttttttgcagggtggtgggtgtgttccctctgtattcattttcctccttcctttatagtgtttgtttagatcttcctttttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39539068 |
gttcgaccatgaggatccttttttgcagggtggtgggtgtgttccctctgtattcattttcctccttcctttatagtgtttgtttagatcttcctttttt |
39538969 |
T |
 |
| Q |
118 |
catttgctcgcttatatgtattcgggtgcatgcccccgatcctaattttaatgcaattcctgacctttattaagaaaaaacacggaagtaaaaagataac |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39538968 |
catttgctcgct--tatgtattcgggtgcatgcccccgatcctaattttaatgcaattcttgacctttattaagaaaaaacacggaagtaaaaagataac |
39538871 |
T |
 |
| Q |
218 |
gtaatgaaaatcacacatatatt |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39538870 |
gtaatgaaaatcacacatatatt |
39538848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University