View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3879_high_60 (Length: 239)
Name: NF3879_high_60
Description: NF3879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3879_high_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 99 - 234
Target Start/End: Original strand, 53935561 - 53935696
Alignment:
| Q |
99 |
cctgtggcaaaggggccttattatcttatctggatcaggaaaaggtccccttttattgaggccaagagacatttnnnnnnnngataaatgaaaaattaat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53935561 |
cctgtggcaaaggggccttattatcttatctggatgaggaaaaggtccccttttattgaggccaagagacatttaaaaaaaagataaatgaaaaattaat |
53935660 |
T |
 |
| Q |
199 |
attgattatagtgatttcaaggattactttacaatc |
234 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
53935661 |
attgcttatagtgatttcaaggattactttacaatc |
53935696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University