View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3879_high_65 (Length: 220)
Name: NF3879_high_65
Description: NF3879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3879_high_65 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 35474492 - 35474283
Alignment:
| Q |
1 |
tataacttggatctaaaagaaaaacaagaatgtgaaatgaaaaattaaacaaa-----cctggataattttcttgcaaattggatggctttgaacattaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35474492 |
tataacttggatctaaaagaaaaacaagaatgtgaaatgaaaaattaaacaaattaaacctggataattttcttgcaaattggatggctttgaacattaa |
35474393 |
T |
 |
| Q |
96 |
tggtgttactaattgatccttgataattttcagacactgataaagatgcttcaagtcctgaaacctcagcattcaacttcctagcttgtgcttgaaggtc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35474392 |
tggtgttactaattgatccttgataattttcagacactgataaagatgtttcaagccctgaaacctcagcatttaacttcctagcttgtgcttgaaggtc |
35474293 |
T |
 |
| Q |
196 |
atgcacatat |
205 |
Q |
| |
|
|||||||||| |
|
|
| T |
35474292 |
atgcacatat |
35474283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 205
Target Start/End: Original strand, 20951373 - 20951450
Alignment:
| Q |
128 |
gacactgataaagatgcttcaagtcctgaaacctcagcattcaacttcctagcttgtgcttgaaggtcatgcacatat |
205 |
Q |
| |
|
||||||| ||| |||||||||||||||| ||||||||| || | |||| | ||||||| |||||| ||||||| |||| |
|
|
| T |
20951373 |
gacactgctaatgatgcttcaagtcctgcaacctcagccttaagcttcttggcttgtgattgaagttcatgcatatat |
20951450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University