View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3879_low_41 (Length: 287)
Name: NF3879_low_41
Description: NF3879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3879_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 279
Target Start/End: Complemental strand, 4580408 - 4580147
Alignment:
| Q |
16 |
catccagaacatgggtttcagtttcagcattttcttatgaagtgtttgnnnnnnntaatctatcaatatgataaaatattgcttatatgaaatggatata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4580408 |
catccagaacatgggtttcagtttcagcattttcttatgaagtgtttgaaaaaaataatctatcaatatgataaaatattgc--atatgaaatggatata |
4580311 |
T |
|
| Q |
116 |
tatagacagaaagaaatagtagagcccatgttacaaatagtttttgtctcaatattttactatcacttgaacaaaatatagagtctcaaattcaaaactt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4580310 |
tatagacagaaagaaatagtagagcccatgttacaaatagtttttgtctcaatattttactatcacttgaacaaaatatagagtctcaaattcaaaactt |
4580211 |
T |
|
| Q |
216 |
caatagttttctttaagtgcacaagtaatgaaacccttatgtattttgatgactcagtcattgc |
279 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4580210 |
caataattttctttaagtgcacaagtaatgaaacccttatgtattttgatgactcggtcattgc |
4580147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University