View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3879_low_42 (Length: 287)
Name: NF3879_low_42
Description: NF3879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3879_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 196 - 272
Target Start/End: Original strand, 24085633 - 24085709
Alignment:
| Q |
196 |
gaattttctattttcatggaaaattcagatacttgagaccttcattttttattgcctggatttcttattgttatttg |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24085633 |
gaattttctattttcatggaaaattcagatacttgagaccttcattttttattgcctggatttcttattgttatttg |
24085709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 187 - 215
Target Start/End: Original strand, 29015289 - 29015317
Alignment:
| Q |
187 |
ttaaacggtgaattttctattttcatgga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29015289 |
ttaaacggtgaattttctattttcatgga |
29015317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University