View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3879_low_42 (Length: 287)

Name: NF3879_low_42
Description: NF3879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3879_low_42
NF3879_low_42
[»] chr5 (2 HSPs)
chr5 (196-272)||(24085633-24085709)
chr5 (187-215)||(29015289-29015317)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 196 - 272
Target Start/End: Original strand, 24085633 - 24085709
Alignment:
196 gaattttctattttcatggaaaattcagatacttgagaccttcattttttattgcctggatttcttattgttatttg 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24085633 gaattttctattttcatggaaaattcagatacttgagaccttcattttttattgcctggatttcttattgttatttg 24085709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 187 - 215
Target Start/End: Original strand, 29015289 - 29015317
Alignment:
187 ttaaacggtgaattttctattttcatgga 215  Q
    |||||||||||||||||||||||||||||    
29015289 ttaaacggtgaattttctattttcatgga 29015317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University