View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3879_low_44 (Length: 278)
Name: NF3879_low_44
Description: NF3879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3879_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 264
Target Start/End: Original strand, 53935944 - 53936189
Alignment:
| Q |
17 |
tgagattgtgtggaaatagagtgtgaaagatctgacttcttgtgattgcttttcaatggtattgcaaatgaccaaagaaaaactctatatcaaatgtttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
53935944 |
tgagattgtgtggaaatagagtgtgaaagatctgacttcttgtgattgcttttcaatggtattgcaaatgaccaaagaaaaactctat--caaatgtttg |
53936041 |
T |
|
| Q |
117 |
atcttgtattgtctttgattgagtctaatcaaattttattatttcgtaatttgatctacgtagcctattccactaattagaattagattttattgttatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| || ||||| |||||||||||||| |
|
|
| T |
53936042 |
atcttgtattgtctttgattgagtctaatcaaattttattatttcgtaatttgatctacgtagcctacttcactaactataattaaattttattgttatt |
53936141 |
T |
|
| Q |
217 |
gttgattgataaattgtattatatatttaagaaatcgagatttaaacc |
264 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
53936142 |
gttgattgataaattgtattatatatataagaagtcgagatttaaacc |
53936189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University