View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3879_low_47 (Length: 269)
Name: NF3879_low_47
Description: NF3879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3879_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 26 - 259
Target Start/End: Complemental strand, 55736781 - 55736548
Alignment:
| Q |
26 |
gaatttaaccgtggtaggttcactgtccaaaacagttttgtacacacaatctatcaacccaccactattaaactcataaataaactctgtcattctaatc |
125 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55736781 |
gaatttaaccgtggtgggttcacggtccaaaacagttttgtacacacaatcgatcaacccaccactattaaactcataaataaactctgtcattctaatc |
55736682 |
T |
|
| Q |
126 |
attcaaaaatatataatcatgtatacccatccaagatcaatggatnnnnnnnggagaccaaaaacaaaatttggtcattctcattcatatgtaattttca |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55736681 |
attcaaaaatatataatcatgtatacccatccaagatcaatggataaaaaaaggagaccaaaaactcaatttggtcattctcattcatatgtaattttca |
55736582 |
T |
|
| Q |
226 |
aggattggtctggacaaaaaataatacttaaatt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
55736581 |
aggattggtctggacaaaaaataatacttaaatt |
55736548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University