View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3879_low_53 (Length: 257)
Name: NF3879_low_53
Description: NF3879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3879_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 106 - 247
Target Start/End: Original strand, 29306496 - 29306634
Alignment:
| Q |
106 |
taaaaaatttagagttcttcacattagtattccagccggcgtaaatgtggctcatcggccatatttgtctgcattttgccgcaatataaaggcttacaac |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29306496 |
taaaaaatttagagttcttcacattagtattgcagccg---taaatgtggctcatcggccatatttgtctgcattttgccgcaatataaaggcttacaac |
29306592 |
T |
|
| Q |
206 |
gcaactgcgatcacagttgctgttttgatctctgaatctctg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29306593 |
gcaactgcgatcacagttgctgttttgatctcagaatctctg |
29306634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University