View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3879_low_54 (Length: 257)
Name: NF3879_low_54
Description: NF3879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3879_low_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 81 - 198
Target Start/End: Complemental strand, 193508 - 193391
Alignment:
| Q |
81 |
ctcttataggtgttgcacagagccttttgagtaatgatgcgaatccaaattctagtctttgagggggaacaagaggattatatgtgtgctgagcttgagc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
193508 |
ctcttataggtgttgcacagagccttttgagtaatgatgcgaatccaaattctagtctttgagggggaacaagaggattatatgtgtgctgagcttgagc |
193409 |
T |
 |
| Q |
181 |
ctttggccagttcataaa |
198 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
193408 |
ctttggtcagttcataaa |
193391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 193622 - 193539
Alignment:
| Q |
1 |
tatagttttcaatattcatttcacaagtacttgcaaacatgatcaagatgttagatgggagttgggtcagggttacgaagctct |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
193622 |
tatagttttcaatattcatttcacaagtacttgcaaacatgatcaagatgttagatgggagttgggtcagggttacgaagctct |
193539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University