View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3879_low_65 (Length: 239)
Name: NF3879_low_65
Description: NF3879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3879_low_65 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 77 - 230
Target Start/End: Complemental strand, 7691436 - 7691283
Alignment:
| Q |
77 |
ttacagccagagaattgcagttgcagaccgcaatttagaactattagcattgcagttcttccgtcttaattttcttgttaagaatattataacaagttat |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7691436 |
ttacagccagagaattgcagttgcagaccgcaatttagaactattagcattgcaattcttttgtcttaattttcttgttaagaatattataacaagttat |
7691337 |
T |
|
| Q |
177 |
gaagatgtttatcatttttattgttctatcacagatagatcacaattgcctatg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7691336 |
gaagatgtttatcatttttattgttctatcacagatagatcacaattgcctatg |
7691283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 7691538 - 7691461
Alignment:
| Q |
1 |
attgcggtcgcaatataaactttgatgttaccatacaatgcggataaatatgcccgcagttgtattttcaatgtcgtt |
78 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
7691538 |
attgcggtcgcaatataaactttgatattacgatacaatgcggataaatatgaccgcaattgtattttcaatgtcgtt |
7691461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University