View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3880_high_13 (Length: 316)
Name: NF3880_high_13
Description: NF3880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3880_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 2 - 307
Target Start/End: Complemental strand, 2331993 - 2331691
Alignment:
| Q |
2 |
gttttaccttctctttaggttgtttggtagaggttttctcttgcaaaaatacttatgtgcagttcttcgaatagctagtgttcatccggttcataacttt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2331993 |
gttttaccttctctttaggttgtttggtagaggttttctcttgcaaaaatacttatgtgcagttcttcgaatagctagtgttcatccggttcataacttt |
2331894 |
T |
|
| Q |
102 |
agttacaaaataaattattaaaactgcccaaccgccattaatccaaatcatttttaaacgacaatgtttaggtacattcatgtgaagaactgagcgaata |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
2331893 |
agttacaaaataaattattaaaactgcccaaccgccattaatccaaatcatttttaaacgacaatgtttaggtgcattcatgtgaaaaactgagcgaata |
2331794 |
T |
|
| Q |
202 |
gtgtgcagggaacgatacctaagtattctcctttcttgtgttggttttcccttttaactgtttttcaccattattggtggtgatcattgttgtttcttag |
301 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2331793 |
gtgtgtagggaacgatacctaagtattctcctttcttgtgttggttttcccttttaactgtttttcacc---attggtggtgatcattgttgtttcttag |
2331697 |
T |
|
| Q |
302 |
tattat |
307 |
Q |
| |
|
|||||| |
|
|
| T |
2331696 |
tattat |
2331691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University