View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3881_high_21 (Length: 246)
Name: NF3881_high_21
Description: NF3881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3881_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 34384136 - 34383973
Alignment:
| Q |
1 |
ttaaataagtttcgttcataaaaatatagcaaaatttgattttagtccctaaacannnnnnnnnnnnnntagtccttaaaaatattgacggaatgttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
34384136 |
ttaaataagtttcgttcataaaaatatagcaaaatttgattttagtccctaaactttttttaaaaaaaatagtccttaaaaatattgacgaaatgttttc |
34384037 |
T |
 |
| Q |
101 |
agcactcca-nnnnnnnnnnnctacttctatcttcactctaatatgctccattctttctctctt |
163 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
34384036 |
agcactccatttttttttcttccacttctatcttcactctaatatgttccatactttctctctt |
34383973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 40966630 - 40966576
Alignment:
| Q |
1 |
ttaaataagtttcgttcataaaaatatagcaaaatttgattttagtccctaaaca |
55 |
Q |
| |
|
|||||||||||| || |||||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
40966630 |
ttaaataagttttgtccataaaaatataacaaattttgattttagtccttaaaca |
40966576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 14046473 - 14046516
Alignment:
| Q |
10 |
tttcgttcataaaaatatagcaaaatttgattttagtccctaaa |
53 |
Q |
| |
|
|||||||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
14046473 |
tttcgttcttataaatatatcaaaatttgattttagtccctaaa |
14046516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University