View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3881_high_24 (Length: 222)
Name: NF3881_high_24
Description: NF3881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3881_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 35 - 208
Target Start/End: Complemental strand, 40674936 - 40674763
Alignment:
| Q |
35 |
actactaaaatggagtaaactcctatttgggttcatgagagtgtcactcgctatcacaattcacacatgcccttaggtaaacataagttattaaaatctc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40674936 |
actactaaaatggagtaaactcctatttgggttcatgagagtgtcactcgctatcacaattcacacatgcccttaggtaaacataagttattaaaatctc |
40674837 |
T |
 |
| Q |
135 |
tcttaatgttagttttgttaatcaaattaatctaaaacattatcttgatgttaactttgatgatatgtccctat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40674836 |
tcttaatgttagttttgttaatcaaattaatctaaaacattatcttgatgttaactttgatgatatgtctctat |
40674763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 114 - 208
Target Start/End: Complemental strand, 4755037 - 4754944
Alignment:
| Q |
114 |
aacataagttattaaaatctctcttaatgttagttttgttaatcaaattaatctaaaacattatcttgatgttaactttgatgatatgtccctat |
208 |
Q |
| |
|
||||||| ||||||||| ||||| |||||||||| |||| |||||||| ||| |||| ||| |||| |||||||||||||||| ||||||||| |
|
|
| T |
4755037 |
aacataaattattaaaacatctctcaatgttagttc-gttagtcaaattagtctgaaacgttaacttggtgttaactttgatgatgtgtccctat |
4754944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 90
Target Start/End: Original strand, 21396294 - 21396340
Alignment:
| Q |
44 |
atggagtaaactcctatttgggttcatgagagtgtcactcgctatca |
90 |
Q |
| |
|
||||||||||| ||| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
21396294 |
atggagtaaacccctgtttgggtccatgaaagtgtcactcgctatca |
21396340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University