View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3881_low_18 (Length: 264)
Name: NF3881_low_18
Description: NF3881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3881_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 24949443 - 24949207
Alignment:
| Q |
17 |
ttttatgttctgagacatcctagattcagacataaacttccatcagttcctcttaatttctttaggaggttacctgctagatcagatagcatgttataga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24949443 |
ttttatgttctgagacatcctagattcagacagaaacttccatcagttcctcttaatttctttaggaggttacctgctagatcagatagcatgttataga |
24949344 |
T |
 |
| Q |
117 |
tcatcattcatgattatgttcatttgatttgggaatattcatgttgttgcaattatgttgtgttataaacattcttttaatgtcaagttttatttctttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24949343 |
tcatcattcatgattatgttcatttgatttgggaatattcatgttgttgcaattatgttgtgttataaacattcttttaatgtcaagttttatttctttg |
24949244 |
T |
 |
| Q |
217 |
agtatgatagtttctagataattttactaattgttcc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24949243 |
agtatgatagtttctagataattttactaattgttcc |
24949207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University