View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3881_low_26 (Length: 237)
Name: NF3881_low_26
Description: NF3881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3881_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 34384280 - 34384509
Alignment:
| Q |
1 |
cccttactttacaaaagttatatcaatgcggttaattatannnnnnnngtcgttgatagaatgtgcttgatttctaacacaatttaaacatatattatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34384280 |
cccttactttacaaaagttatatcaatgcggttaattatatattttttgtcgttgatagaatgtgcttgatttctaacacaatttaaacatatattatca |
34384379 |
T |
|
| Q |
101 |
tatgttgaaataattaaaaaataaagattacact---------cttcttttacaaaagttatatcaatgtggttaatttagttatttaacagaatgtggt |
191 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34384380 |
tatgtcgaaataattaaaaaataaagattacaccaaagtggtccttcttttacaaaagttatatcaatgtggttaatttagttatttaacagaatgtggt |
34384479 |
T |
|
| Q |
192 |
cgatttctatacaatttaaacatatattat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34384480 |
cgatttctatacaatttaaacatatattat |
34384509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University