View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3882_high_13 (Length: 242)
Name: NF3882_high_13
Description: NF3882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3882_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 20 - 227
Target Start/End: Complemental strand, 54266570 - 54266362
Alignment:
| Q |
20 |
ctaaggaatggggttagaaaaatttgtgctggcagaattgtgatagccggctgaaagatggttgtttgtggccgtctgtaaaatcggctctatgttaaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54266570 |
ctaaggaatggggttagaaaaatttgtgctggcagaattgtgatagccggctgaaagatggttgtttgtggccgtctgtaaaatcggctctatgttaaat |
54266471 |
T |
 |
| Q |
120 |
tctttctctcttgtcttctcttcaaaattctgtgatgtagctgtcaataagtttctgaatctgttttatatgcctttttatttgtaagcttaatcag-tt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54266470 |
tctttctctcttgtcttctcttcaaaattctgtgatgtagctgtcaataagtttctgaatctgttttatatgcctttttatttgtaagcttaatcagttt |
54266371 |
T |
 |
| Q |
219 |
tattctctg |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
54266370 |
tattctctg |
54266362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University