View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3882_low_12 (Length: 251)
Name: NF3882_low_12
Description: NF3882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3882_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 24885277 - 24885037
Alignment:
| Q |
1 |
cgagctcagccaccctcttagtcaattcctctgcatatttgtgagtagcattaactattcctcgtacttggttagggcctggatttctttgtctttatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24885277 |
cgagctcagccaccctcttagtcaattcctccgcatatttgtgagtagcattaactattcctcgtgcttggttagggcctggatttctttgtctttatga |
24885178 |
T |
|
| Q |
101 |
gaaaacttcatgatcacacccatctaaatttcatgcttgtccttgtaatcaacaacgtcggctccaacttggccaaattaagctcaaaggccaccttctt |
200 |
Q |
| |
|
||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24885177 |
gaacactccataatcacacccatctaaatttcatgcttgtccttgtaatcaacaacgtcggctccaacttggccaaattaagctcaaaggccaccttctt |
24885078 |
T |
|
| Q |
201 |
attaaagaatctctcaggtcaggcctcgtactcactctctg |
241 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24885077 |
attaaagaatctctcagctcaggcctcgtactcactctctg |
24885037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University