View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3882_low_14 (Length: 246)
Name: NF3882_low_14
Description: NF3882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3882_low_14 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 152 - 246
Target Start/End: Complemental strand, 24885385 - 24885291
Alignment:
| Q |
152 |
ggccactaagcctggttttcttcttctacttcttcatcctcttccccagaagatcgctacattcggtggccgacttcaacgcagattcaagccct |
246 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24885385 |
ggccactaagcctgattttcttcttctacttcttcatcctcttccccaggagatcgctacattcggtggccgacttcaacgcagattcaagccct |
24885291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 18 - 87
Target Start/End: Complemental strand, 24885519 - 24885450
Alignment:
| Q |
18 |
acgaaaatacttgttgaaaataaaacatgaaccgtaaacaagtaaaaattgcattaaatacatgcacaac |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24885519 |
acgaaaatacttgttgaaaataaaacatgaaccgtaaacaagtaaaaattgcattaaaaacatgcacaac |
24885450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University