View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3883_high_20 (Length: 232)

Name: NF3883_high_20
Description: NF3883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3883_high_20
NF3883_high_20
[»] chr4 (1 HSPs)
chr4 (14-222)||(31570104-31570312)


Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 31570312 - 31570104
Alignment:
14 gtagtcttcatttcttgtcgttatgctgcccttaaataatgcattacacatgaacaagattagagagggttaagacaaaccaaaatattttagttttaaa 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31570312 gtagtcttcatttcttgtcgttatgctgcccttaaataatgcattacacatgaacaagattagagagggttaagacaaaccaaaatattttagttttaaa 31570213  T
114 gaccaaaattaagagtttaaataattcaaattaaggccatggaggacaaagggtaaggcaaagagtgaaacatgggaaagtgtcatacagagtgtccctg 213  Q
    |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31570212 gaccaaaattaagagtctaaataattcaagttaaggccatggaggacaaagggtaaggcaaagagtgaaacatgggaaagtgtcatacagagtgtccctg 31570113  T
214 atgatgatg 222  Q
    |||||||||    
31570112 atgatgatg 31570104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University