View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3883_high_9 (Length: 400)
Name: NF3883_high_9
Description: NF3883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3883_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 386
Target Start/End: Complemental strand, 29413354 - 29412990
Alignment:
| Q |
1 |
ctcgtacggattttaatccctcttggaaatgtttgtagaatgatcattagtgttactctatttatacaaggaatgactctcattttt-cattatttattg |
99 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29413354 |
ctcgtactgattttaatccctcttggaaatgtttgtagaatgatcattagtgttactctatttatacaaggaatgactctcattttttcattatttattt |
29413255 |
T |
|
| Q |
100 |
ctatcgatcattttgtgcacatgcaatccaatgaccctgcacatgcctgtgaactgtgaaacttttagttttttcctttcttcccaaaagtagtagtttt |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29413254 |
ctatcgatcattttgt----------------------gcacatgcctgtgaactgtgaaacttttagtttttttctttcttcccaaaagtagtagtttt |
29413177 |
T |
|
| Q |
200 |
cttgtagatgtatgcattgttgtgatgaaatcagacatcttttttggtcaacctagctgccctacctctcccctgcctgcataattgcttttgctatgta |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
29413176 |
cttgtagatgtatgcattgttgtgatgaaatcagacaccttttttggtcaacctaactgccctacctctcccctgcctgcataattgtttttgctacgtg |
29413077 |
T |
|
| Q |
300 |
tgtttgtttttcactttttggttttgtagttaaattagaactctgatatcaactttttgatgaagacaaaagatggcaggaactgaa |
386 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29413076 |
cgtttgtttttcactttttggttttgtagtaaaattagaactctgatatcaactttttgatgaagacaaaagatggcaggaactgaa |
29412990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 184; Significance: 2e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 150 - 386
Target Start/End: Original strand, 10160947 - 10161189
Alignment:
| Q |
150 |
gaactgtgaaacttttagttttttcctttcttcccaaaagtagtagttttcttgtagatgtatgcattgttgtgatgaaatcagacatcttttttggtca |
249 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||| ||| |
|
|
| T |
10160947 |
gaactgtgaaacttttagtttttttctttcttcccaaaagtagtagttttctcgtagatgtatgcattgttgtgatgaaatcgaacaccttttttgatca |
10161046 |
T |
|
| Q |
250 |
acctagctgccctacctctcccctgcctgcataattgcttttgctatgtatgtttgtttttcact------ttttggttttgtagttaaattagaactct |
343 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
10161047 |
acctaactgccctacctctcccctgcctgcataattgcttttgctatgtatgtttgtttttcactttttggttttggttttgtagtaaaattagaactct |
10161146 |
T |
|
| Q |
344 |
gatatcaactttttgatgaagacaaaagatggcaggaactgaa |
386 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10161147 |
gatagcaactttttgatgaagacaaaagatggcaggaactgaa |
10161189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University