View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3883_low_18 (Length: 256)
Name: NF3883_low_18
Description: NF3883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3883_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 73 - 238
Target Start/End: Complemental strand, 39366566 - 39366401
Alignment:
| Q |
73 |
aatagttaacaatagcataggctatgggttaattaataatcagtaattcagtatgctatttttagcctaaagacagttgcatttatttggtatattgcgt |
172 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39366566 |
aataattaacaatagcatcggctatgggttaat----aatcagtaattcagtatgctatttttagcttaaagacagttgcatttatttggtatattgcgt |
39366471 |
T |
 |
| Q |
173 |
gacacatgatatgaat----cacatgctagagatgttaggataataatcccatctagtctagggttctga |
238 |
Q |
| |
|
|||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39366470 |
gacacatgatatgaatcatacatatgcttgagatgttaggataataatcccatctagtctagggttctga |
39366401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 74
Target Start/End: Complemental strand, 39366638 - 39366594
Alignment:
| Q |
30 |
tgtgcttatgtggataccaaaacacaatgctgcatcacatcacaa |
74 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
39366638 |
tgtgcttatgtggacacccaaacacaatgcagcatcacatcacaa |
39366594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University