View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3883_low_18 (Length: 256)

Name: NF3883_low_18
Description: NF3883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3883_low_18
NF3883_low_18
[»] chr2 (2 HSPs)
chr2 (73-238)||(39366401-39366566)
chr2 (30-74)||(39366594-39366638)


Alignment Details
Target: chr2 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 73 - 238
Target Start/End: Complemental strand, 39366566 - 39366401
Alignment:
73 aatagttaacaatagcataggctatgggttaattaataatcagtaattcagtatgctatttttagcctaaagacagttgcatttatttggtatattgcgt 172  Q
    |||| ||||||||||||| ||||||||||||||    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
39366566 aataattaacaatagcatcggctatgggttaat----aatcagtaattcagtatgctatttttagcttaaagacagttgcatttatttggtatattgcgt 39366471  T
173 gacacatgatatgaat----cacatgctagagatgttaggataataatcccatctagtctagggttctga 238  Q
    ||||||||||||||||    || ||||| |||||||||||||||||||||||||||||||||||||||||    
39366470 gacacatgatatgaatcatacatatgcttgagatgttaggataataatcccatctagtctagggttctga 39366401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 74
Target Start/End: Complemental strand, 39366638 - 39366594
Alignment:
30 tgtgcttatgtggataccaaaacacaatgctgcatcacatcacaa 74  Q
    |||||||||||||| ||| ||||||||||| ||||||||||||||    
39366638 tgtgcttatgtggacacccaaacacaatgcagcatcacatcacaa 39366594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University