View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3883_low_21 (Length: 238)
Name: NF3883_low_21
Description: NF3883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3883_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 32765955 - 32765750
Alignment:
| Q |
18 |
tttatttgttattggttgctgatgcagggagaaaccagacaggcctttccgttgccttgattgtcaatataggagagaactagttagggtatatttgaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32765955 |
tttatttgttattggttgctgatgcagggagaaaccagacaggcctttccgttgccttgattgtcaatataggagagaactagttaaggtatatttgaca |
32765856 |
T |
 |
| Q |
118 |
aatgtagaacaaatttgtcggcgttttgtggaggaaagacgaagcaagcttgggaagttgatagaggataaagctaggtggttgaggtactttatgctct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32765855 |
aatgtagaacaaatttgtcggcgttttgtggaggaaagacgaagcaagcttgggaagttgatagaggataaagctaggtggttgaggta---tatgctct |
32765759 |
T |
 |
| Q |
218 |
cctttgata |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
32765758 |
cctttgata |
32765750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 26 - 226
Target Start/End: Complemental strand, 32755563 - 32755363
Alignment:
| Q |
26 |
ttattggttgctgatgcagggagaaaccagacaggcctttccgttgccttgattgtcaatataggagagaactagttagggtatatttgacaaatgtaga |
125 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32755563 |
ttattggttgctgctgcagggagaaatcagacaggcctttccgttgccttgattgtcattataggagagaacttgttagggtatatttgacaaatgtaga |
32755464 |
T |
 |
| Q |
126 |
acaaatttgtcggcgttttgtggaggaaagacgaagcaagcttgggaagttgatagaggataaagctaggtggttgaggtactttatgctctcctttgat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32755463 |
acaaatttgtcggcgttttgtggaggaaagacgaagcaagcttgggaagttgatagaggataaagctaggtggtcgaggtactttatgctctcctttgat |
32755364 |
T |
 |
| Q |
226 |
a |
226 |
Q |
| |
|
| |
|
|
| T |
32755363 |
a |
32755363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 42 - 199
Target Start/End: Original strand, 16774822 - 16774979
Alignment:
| Q |
42 |
cagggagaaaccagacaggcctttccgttgccttgattgtcaatataggagagaactagttagggtatatttgacaaatgtagaacaaatttgtcggcgt |
141 |
Q |
| |
|
|||||| ||| | ||||||||||| |||||||||||||| || ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16774822 |
cagggaaaaagctgacaggccttttcgttgccttgattgccagtataggagagagcttgttagggtctatttgacaaatgtagaacaaatttgtcggcgt |
16774921 |
T |
 |
| Q |
142 |
tttgtggaggaaagacgaagcaagcttgggaagttgatagaggataaagctaggtggt |
199 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
16774922 |
tttgtggaggagagaagaagcaagcttgggaagctgatagaggataaagctaagtggt |
16774979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University