View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3883_low_23 (Length: 232)
Name: NF3883_low_23
Description: NF3883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3883_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 31570312 - 31570104
Alignment:
| Q |
14 |
gtagtcttcatttcttgtcgttatgctgcccttaaataatgcattacacatgaacaagattagagagggttaagacaaaccaaaatattttagttttaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31570312 |
gtagtcttcatttcttgtcgttatgctgcccttaaataatgcattacacatgaacaagattagagagggttaagacaaaccaaaatattttagttttaaa |
31570213 |
T |
|
| Q |
114 |
gaccaaaattaagagtttaaataattcaaattaaggccatggaggacaaagggtaaggcaaagagtgaaacatgggaaagtgtcatacagagtgtccctg |
213 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31570212 |
gaccaaaattaagagtctaaataattcaagttaaggccatggaggacaaagggtaaggcaaagagtgaaacatgggaaagtgtcatacagagtgtccctg |
31570113 |
T |
|
| Q |
214 |
atgatgatg |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
31570112 |
atgatgatg |
31570104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University