View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3884_high_11 (Length: 290)
Name: NF3884_high_11
Description: NF3884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3884_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 18 - 275
Target Start/End: Complemental strand, 9574707 - 9574446
Alignment:
| Q |
18 |
aagatcaaatatctcttctgaagttcaagaagtgtgcttgtttatacataacccaaaaacacaacacatgtctttttgaaaagtattatt------attc |
111 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
9574707 |
aagatcaaatatctcttatgaagttcaagaagtgtgcttgtttatacataccccaaaaacacaacacatgtctttatgaaaagtattattcattacattc |
9574608 |
T |
 |
| Q |
112 |
atggcactattgagtttagcctcaacctatannnnnnnnnnnnnnnnnggaaaactactcacttatacaaacacagactgggctggatgtcccaacacaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||| |||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
9574607 |
atggcactattgagtttagcctcaacctatatctctctctcctctctcg--aaactactcgcttatacaaacatagactgggctagatgtcccgacacaa |
9574510 |
T |
 |
| Q |
212 |
gaagatatatctcttattattgagtatatattggtgataatttgatctcttattatgcaaaaat |
275 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9574509 |
gaagatatatctctaattattgagtatatattggtgataacttgatctcttattatgcaaaaat |
9574446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 190 - 262
Target Start/End: Complemental strand, 875680 - 875608
Alignment:
| Q |
190 |
tgggctggatgtcccaacacaagaagatatatctcttattattgagtatatattggtgataatttgatctctt |
262 |
Q |
| |
|
|||||||||||||| |||||||||||| || |||| ||||| |||||| |||| || ||||||||||||| |
|
|
| T |
875680 |
tgggctggatgtccagacacaagaagatctacctctaggtattgtgtatatcttggagacaatttgatctctt |
875608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University