View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3884_low_14 (Length: 262)
Name: NF3884_low_14
Description: NF3884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3884_low_14 |
 |  |
|
| [»] scaffold0115 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0115 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: scaffold0115
Description:
Target: scaffold0115; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 45594 - 45848
Alignment:
| Q |
1 |
aaggaacttggtaagtgcgttataaaatccatagatagatctatccacacttgttgagggattggtaatggtttgagtaacccctgttttttggttggca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45594 |
aaggaacttggtaagtgcgttataaaatccatagatagatctatccacacttgttgagggattggtaatggtttgagtaacccctgtttcttggttggca |
45693 |
T |
 |
| Q |
101 |
tgtacttactcttatggaaaatttcgcacctaaggacccagtgtttgatatctttataggcatatggttaaagaaacgatgcggccattctggatagagt |
200 |
Q |
| |
|
| ||||||||||| || |||||||||||||| |||||||| ||||| | |||||||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
45694 |
tttacttactcttctgaaaaatttcgcacctgaggacccaatgtttcacatctttataggcatctggtcaaagaaacgatgcggccattctggctagagt |
45793 |
T |
 |
| Q |
201 |
tggctggagactggagtgtcctgaaagaggtgtgtcatgaaactctttgatgatg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794 |
tggctggagactggagtgtcctgaaagaggtgtgtcatgaaactctttgatgatg |
45848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University