View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3884_low_18 (Length: 239)
Name: NF3884_low_18
Description: NF3884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3884_low_18 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 9 - 239
Target Start/End: Complemental strand, 30343147 - 30342917
Alignment:
| Q |
9 |
acatcatcaacctctctcttccttctttcccttcatctctccaagaacttgttttcatccaaaacccttctattgtttcacctctccaaccttttctcac |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30343147 |
acatcattaacctctctcttccttctttcccttcatctctccaagaacttgttttcatccaaaacccttctattgtttcacctctccaaccttttctcac |
30343048 |
T |
|
| Q |
109 |
aaatctcacttctcttaggaggcttgtcttgatcggaaatggctttcacggcgaacttccgtcgcagattgctgattttattgacatggaggagcttact |
208 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
30343047 |
aaatctcacttctcttaggagacttgtcttgatcggaaatgggtttcacggtgaacttccgtcgcagattggtgattttattgacatggaagagcttact |
30342948 |
T |
|
| Q |
209 |
ctatcaaaaaacaatctctccggtgcggttc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
30342947 |
ctatcaaaaaacaatctctccggtgcggttc |
30342917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 71 - 165
Target Start/End: Original strand, 30333089 - 30333183
Alignment:
| Q |
71 |
aacccttctattgtttcacctctccaaccttttctcacaaatctcacttctcttaggaggcttgtcttgatcggaaatggctttcacggcgaact |
165 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||| ||||||| ||||| | ||| || |||||| |||||||||| |||||||| ||||| |
|
|
| T |
30333089 |
aacccttctgttgtttcacctctccagccttttctccataatctcaactctctcaagagactggtcttggtcggaaatgggtttcacggtgaact |
30333183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University