View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3884_low_19 (Length: 228)
Name: NF3884_low_19
Description: NF3884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3884_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 30 - 212
Target Start/End: Complemental strand, 489683 - 489501
Alignment:
| Q |
30 |
gtgttaattgtgaatcgcagaaaataatggtttattcaaacttcgttatgctacagtgttatagtgcttatatagctgctatatatttgacaacacttta |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
489683 |
gtgttaattgtgaatcgcagaaaataatggtttattcaaacttcgttatgctatagtgttatagtgctgatatagctgctatatatttgacaacacttta |
489584 |
T |
|
| Q |
130 |
tactaacaagtatattgcggaacaataatgatttgatcaaattatgtgtcgtagcaactattctaccgactttgaacatctct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
489583 |
tactaacaagtatattgcggaacaataatgatttgatcaaattatgtgtcgtagcaactattctaccgactttgaacatctct |
489501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 113 - 172
Target Start/End: Complemental strand, 24769368 - 24769309
Alignment:
| Q |
113 |
tatttgacaacactttatactaacaagtatattgcggaacaataatgatttgatcaaatt |
172 |
Q |
| |
|
|||||||||| ||||| |||||| ||| |||||| |||||||||||||||| ||||||| |
|
|
| T |
24769368 |
tatttgacaatactttgtactaaatagtgtattgcagaacaataatgatttgttcaaatt |
24769309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 113 - 164
Target Start/End: Original strand, 50402655 - 50402706
Alignment:
| Q |
113 |
tatttgacaacactttatactaacaagtatattgcggaacaataatgatttg |
164 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
50402655 |
tatttgacaacactttatactaaatagcatattgcggaacaatagtgatttg |
50402706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University