View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3884_low_19 (Length: 228)

Name: NF3884_low_19
Description: NF3884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3884_low_19
NF3884_low_19
[»] chr6 (2 HSPs)
chr6 (30-212)||(489501-489683)
chr6 (113-172)||(24769309-24769368)
[»] chr3 (1 HSPs)
chr3 (113-164)||(50402655-50402706)


Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 30 - 212
Target Start/End: Complemental strand, 489683 - 489501
Alignment:
30 gtgttaattgtgaatcgcagaaaataatggtttattcaaacttcgttatgctacagtgttatagtgcttatatagctgctatatatttgacaacacttta 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||    
489683 gtgttaattgtgaatcgcagaaaataatggtttattcaaacttcgttatgctatagtgttatagtgctgatatagctgctatatatttgacaacacttta 489584  T
130 tactaacaagtatattgcggaacaataatgatttgatcaaattatgtgtcgtagcaactattctaccgactttgaacatctct 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
489583 tactaacaagtatattgcggaacaataatgatttgatcaaattatgtgtcgtagcaactattctaccgactttgaacatctct 489501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 113 - 172
Target Start/End: Complemental strand, 24769368 - 24769309
Alignment:
113 tatttgacaacactttatactaacaagtatattgcggaacaataatgatttgatcaaatt 172  Q
    |||||||||| ||||| ||||||  ||| |||||| |||||||||||||||| |||||||    
24769368 tatttgacaatactttgtactaaatagtgtattgcagaacaataatgatttgttcaaatt 24769309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 113 - 164
Target Start/End: Original strand, 50402655 - 50402706
Alignment:
113 tatttgacaacactttatactaacaagtatattgcggaacaataatgatttg 164  Q
    |||||||||||||||||||||||  || |||||||||||||||| |||||||    
50402655 tatttgacaacactttatactaaatagcatattgcggaacaatagtgatttg 50402706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University