View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3884_low_21 (Length: 219)
Name: NF3884_low_21
Description: NF3884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3884_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 22302778 - 22302974
Alignment:
| Q |
1 |
aaaaaaccatattgtaaaggaagaaagacaatcttgcaatgattcacttttaccatcaccaaaaatggaaaataaattcttacaaagattcacatgccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
22302778 |
aaaaaaccatattgtaaaggaagaaagacaatcttgcaatgattcactt--accatcaccaaaaatggaaaataaattcttacaa-gattcacataccat |
22302874 |
T |
|
| Q |
101 |
catcactaagaatggaaaataaaaggaaaaacacatttgtcaatcatccagaccannnnnnngggttcggattatataattcggtgacaaaattagaaat |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22302875 |
c---actaagaatggaaaataaaaggaaaaacacatttgtcaatcatccagacca-ttttttgggttcggattatataattcggtgacaaaattagaaat |
22302970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University