View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3885_low_7 (Length: 237)
Name: NF3885_low_7
Description: NF3885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3885_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 22 - 224
Target Start/End: Complemental strand, 1111146 - 1110944
Alignment:
| Q |
22 |
gaaagaatgagtgatatatttctctcccatgttctgcaaggttttataaaggagaggataaatatcaaatttgtgggactctcccgaacactaagaatta |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1111146 |
gaaagaatgagtgatatatttctctcccatgttctgcaaggttttataaaggagaggataaatatcaaatttgtgggactctcccgaacactaaggatta |
1111047 |
T |
 |
| Q |
122 |
caggagaaaggcaactacttggtagcaacaaatggagcctatttgaccaatcatatcctgttccagaaaattgtgaggtggaaaaacttcaaggcaagtt |
221 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1111046 |
ctggagaaaggcaactacttggtagcaacaaatggagcctatttgaccaatcatatcctgttccagaaaattgtgaggtggaaaaacttcaaggcaagtt |
1110947 |
T |
 |
| Q |
222 |
tga |
224 |
Q |
| |
|
||| |
|
|
| T |
1110946 |
tga |
1110944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 148 - 224
Target Start/End: Original strand, 18109756 - 18109832
Alignment:
| Q |
148 |
aacaaatggagcctatttgaccaatcatatcctgttccagaaaattgtgaggtggaaaaacttcaaggcaagtttga |
224 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||| |||||| || |||||| ||| ||| ||||| |
|
|
| T |
18109756 |
aacaaatggagaaaatttgaccaaacatatcctgttccagaaaatagtgaggcagagaaacttgaagccaaatttga |
18109832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University