View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3886_low_1 (Length: 397)
Name: NF3886_low_1
Description: NF3886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3886_low_1 |
 | |
|
| [»] scaffold0740 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0740 (Bit Score: 121; Significance: 7e-62; HSPs: 1)
Name: scaffold0740
Description:
Target: scaffold0740; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 91 - 379
Target Start/End: Complemental strand, 2071 - 1778
Alignment:
| Q |
91 |
agttcctattagcttagaaccctccttgggtagaatttatcctatgattgtgtgagaaaact----agtaagtttatctagtgtatgtttaattcctccg |
186 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||| ||||||||||||||||| |||| | || |
|
|
| T |
2071 |
agttcctattagtttagaaccctccttgggtagaatgtatgctatgattgtgtgagaaaactactaagtaattttatctagtgtatgttaaattgcccca |
1972 |
T |
|
| Q |
187 |
tgatgtgttgctattgtgactgtgattgtgattgaacttataactattttg-aaatgcctggtgatgaattacacaatgttcggttgctgggatttattt |
285 |
Q |
| |
|
||||||||| |||||| | ||| |||||| ||||||| |||| | ||||| |||||| |||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
1971 |
tgatgtgtttctattgctattgtcattgtgtttgaactgataattgttttgaaaatgcttggtgatgaattacacaaagttcggttgctgggatttgttt |
1872 |
T |
|
| Q |
286 |
ttctaacatgtgcaatcggttgcactgtcctatgcaaccaatttcacccctccaaatagtgcaattcgtttcactaaatggtgcaaccggttgt |
379 |
Q |
| |
|
| ||| |||||| ||||||||||||| ||| ||||| | || |||||||||||||| ||| | ||||| |||||||||||||||||||| |
|
|
| T |
1871 |
tataaacccgtgcaaccggttgcactgtcttatacaaccggtatcgcccctccaaatagttcaactggtttcggtaaatggtgcaaccggttgt |
1778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 91 - 127
Target Start/End: Original strand, 20926452 - 20926488
Alignment:
| Q |
91 |
agttcctattagcttagaaccctccttgggtagaatt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20926452 |
agttcctattagcttagaaccctccttgggtagaatt |
20926488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University