View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3887_low_7 (Length: 250)
Name: NF3887_low_7
Description: NF3887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3887_low_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 8 - 250
Target Start/End: Complemental strand, 3311146 - 3310902
Alignment:
| Q |
8 |
aagcaaaggagcatttaagagtagtgtctctttcttgacctctcacacacgccacacacaacatgtacaaaaggctgctccatgtccaagcctcatattt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3311146 |
aagcaaaggagcatttaagagtagtgtctctttcttgacctctcacacacgccacacacaacatgtacaaaaggctgctccatgtccaagcctcatattt |
3311047 |
T |
|
| Q |
108 |
gtcatttatgaagatatttttacagttgaaaaccctctcactcagacctagtttatagttcaatctgcaaaagcagcagcactcatttctcctctctatc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3311046 |
gtcatttatgaagatatttttacagttgaaaaccctctcactcagacctagtttatagtgcaatctgcaaaagcagcaacactcatttctcctctctatc |
3310947 |
T |
|
| Q |
208 |
ctcacatatcaatcatcag--tttaacgagatctgatgacatgcc |
250 |
Q |
| |
|
||||||||||| | ||||| |||||||||||||||||||||||| |
|
|
| T |
3310946 |
ctcacatatcagttatcagtttttaacgagatctgatgacatgcc |
3310902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University