View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3888_high_6 (Length: 344)
Name: NF3888_high_6
Description: NF3888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3888_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 16 - 323
Target Start/End: Complemental strand, 24240010 - 24239699
Alignment:
| Q |
16 |
cattacatgcatgttattttcatactacaaacactagaactcactcaattggtaacgcagcaacataatttttgattaattacaaaatcgcaataaccgc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
24240010 |
cattacatgcatgttattttcatactacaaacactagaactcactcaattggtaacgcagcaacataatttttgatcaattacaaattcgcaataaccgc |
24239911 |
T |
 |
| Q |
116 |
caaaacgaaagcccttttgcttgcagtcatccatgcagcgtggagtacaattaataaagcaacatgacaaatttgggcgccccacaacgcatgtattagc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24239910 |
caaaacgaaagcccttttgcttgcagtcatccatgcagcgtggagtacaattcataaagcaacatgacaaatttgggcgccccacaacgcatgtattagc |
24239811 |
T |
 |
| Q |
216 |
tttctcaacctctacc----cgaagctggtgatgttgttggagctgactgacctcggacaccggcggcgaagacaatgcagattaatgcaagtgagagaa |
311 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24239810 |
tttctcaacctctacctgatcgaagctggtgatgttgttggagctgcctgacctcggacaccggcggcgaagacaatgcatattaatgcaagtgagagaa |
24239711 |
T |
 |
| Q |
312 |
cgcttttcctat |
323 |
Q |
| |
|
|||||||||||| |
|
|
| T |
24239710 |
cgcttttcctat |
24239699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 318
Target Start/End: Complemental strand, 5788049 - 5788007
Alignment:
| Q |
276 |
cggcgaagacaatgcagattaatgcaagtgagagaacgctttt |
318 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
5788049 |
cggcgaagacaatgcagatcaatgcgagtgagagaacgttttt |
5788007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University