View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3888_low_13 (Length: 251)
Name: NF3888_low_13
Description: NF3888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3888_low_13 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 40340893 - 40340842
Alignment:
| Q |
200 |
aaatattgttttgggttttatgttatatagctggaattggaatgggttgtac |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40340893 |
aaatattattttgggttttatgttatatagctggaattggaatgggttgtac |
40340842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 48
Target Start/End: Complemental strand, 40341082 - 40341044
Alignment:
| Q |
10 |
aaatgaaagggacaagttcaccactaacggacatgcatg |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40341082 |
aaatgaaagggacaagttcaccactaacggacatgcatg |
40341044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University