View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3888_low_4 (Length: 389)
Name: NF3888_low_4
Description: NF3888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3888_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 2e-37; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 41344357 - 41344448
Alignment:
| Q |
1 |
atgctacaacattgctcctttgttgctccctctaaagaaaataataattttaatacccattagttaacgtagaaatcggtcattagcaaagc |
92 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41344357 |
atgctacaatattactcctttgttgctccctctaaagaaaataataattttaatacccattagttaacgcagaaatcggtcattagcaaagc |
41344448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 299 - 389
Target Start/End: Original strand, 41344568 - 41344654
Alignment:
| Q |
299 |
ctaaaacataaacatgtgatcgcaaccggttgtgggtc-gtgagtccgtgactacaaatagcaagttgtcaccttggtcaataggtggacct |
389 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||| | || |||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
41344568 |
ctaaaacataaaccagtgatcgcaaccggttgtgggtccgtgact-----acaacaaatagcaagttgtcaacttggtcaatagatggacct |
41344654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 170 - 203
Target Start/End: Original strand, 41344527 - 41344560
Alignment:
| Q |
170 |
aaataatacttttcagtattaaccatccgatttc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41344527 |
aaataatacttttcagtattaaccatccgatttc |
41344560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University