View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3888_low_4 (Length: 389)

Name: NF3888_low_4
Description: NF3888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3888_low_4
NF3888_low_4
[»] chr3 (3 HSPs)
chr3 (1-92)||(41344357-41344448)
chr3 (299-389)||(41344568-41344654)
chr3 (170-203)||(41344527-41344560)


Alignment Details
Target: chr3 (Bit Score: 80; Significance: 2e-37; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 41344357 - 41344448
Alignment:
1 atgctacaacattgctcctttgttgctccctctaaagaaaataataattttaatacccattagttaacgtagaaatcggtcattagcaaagc 92  Q
    ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
41344357 atgctacaatattactcctttgttgctccctctaaagaaaataataattttaatacccattagttaacgcagaaatcggtcattagcaaagc 41344448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 299 - 389
Target Start/End: Original strand, 41344568 - 41344654
Alignment:
299 ctaaaacataaacatgtgatcgcaaccggttgtgggtc-gtgagtccgtgactacaaatagcaagttgtcaccttggtcaataggtggacct 389  Q
    |||||||||||||  ||||||||||||||||||||||| |||| |     || |||||||||||||||||| |||||||||||| |||||||    
41344568 ctaaaacataaaccagtgatcgcaaccggttgtgggtccgtgact-----acaacaaatagcaagttgtcaacttggtcaatagatggacct 41344654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 170 - 203
Target Start/End: Original strand, 41344527 - 41344560
Alignment:
170 aaataatacttttcagtattaaccatccgatttc 203  Q
    ||||||||||||||||||||||||||||||||||    
41344527 aaataatacttttcagtattaaccatccgatttc 41344560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University