View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3889_high_10 (Length: 291)

Name: NF3889_high_10
Description: NF3889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3889_high_10
NF3889_high_10
[»] chr4 (1 HSPs)
chr4 (20-269)||(34628562-34628811)


Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 20 - 269
Target Start/End: Original strand, 34628562 - 34628811
Alignment:
20 taattatgttgagtttatattatgttctgttaagaaatggctaattatatttggtttaattttagtatgtcatgtgtgacacaggcagggggaccctatt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34628562 taattatgttgagtttatattatgttctgttaagaaatggctaattatatttggtttaattttagtatgtcatgtgtgacacaggcagggggaccctatt 34628661  T
120 accaagtgaagaagggaagatgggatggaaagatatcaatggcatcaagggtagggtcaaacatcccccgtgcaaactcaaccgttgatgagctcatcaa 219  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34628662 atcaagtgaagaagggaagatgggatggaaagatatcaatggcatcaagggtagggtcaaacatcccccgtgcaaactcaaccgttgatgagctcatcaa 34628761  T
220 aatcttcaattcaaaaggcttaaccatacaggacatggttgctctctctg 269  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||    
34628762 aatcttcaattcaaaaggcttaaccatacaggacatggttgctctttctg 34628811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University