View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3889_low_12 (Length: 300)
Name: NF3889_low_12
Description: NF3889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3889_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 22 - 288
Target Start/End: Complemental strand, 34353360 - 34353089
Alignment:
| Q |
22 |
gcgtgtaccttatcttcttttaataatgttatgtgatctgagaattctcaacaagcaacaatggtttcttcctccttagtcaagtctttgtcttgtgctt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34353360 |
gcgtgtaccttatcttcttttaataatgttatgtgatctgagaattctcaacaagcgacaatggtttcttcctccttagtgaagtctttgtcttgtgctt |
34353261 |
T |
 |
| Q |
122 |
ttcgtgcctgccgtatcaaccactctttcagctccaccaggatcttttcgtcttccattgtctctgtcgaatcccaaactagcaatgatgatctcaatat |
221 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34353260 |
ttcgtgcctgccgtatcagccactctttcagctccaccaggatcttttcgtcttccattgtctctgtcgaatcccaaactagcaacgatgatctcaatat |
34353161 |
T |
 |
| Q |
222 |
tgccgatgatattacacaggtcggtttcacactatttttgttttgt-----tttgcttattttgtctgtgct |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34353160 |
tgccgatgatattacacaggtcggtttcacactatttttgttttgttttgttttgcttattttgtctgtgct |
34353089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 22 - 270
Target Start/End: Complemental strand, 34358985 - 34358735
Alignment:
| Q |
22 |
gcgtgtaccttatcttcttttaataatgttatgtgatctgagaattctcaacaagcaacaatggtttcttcctccttagtcaagtctttgtcttgtgctt |
121 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34358985 |
gcgtgtaccttatcttcttttaacaatgttatgtgatctgagaattctcaacaaacaacaatggcttcttcctccttagtcaagtctttgacttgtgctt |
34358886 |
T |
 |
| Q |
122 |
ttcgtgcctgccgtatcaaccactctttcagctccaccaggatcttttcgtcttccattgtctctgtcgaatcccaaactagcaatgatgatctcaatat |
221 |
Q |
| |
|
| ||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
34358885 |
tgcgtgctggccgtatcagccactgtttcagctccaccaggatcttttcgtcttccactgtttatgtcgaatcccaaactagcaacgatgttctcaatat |
34358786 |
T |
 |
| Q |
222 |
tgccgatgatattacacaggtcggtttc--acactatttttgttttgtttt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34358785 |
tgccgatgatattacacaggtcggtttcacacactatttttgttttgtttt |
34358735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University