View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3889_low_13 (Length: 291)
Name: NF3889_low_13
Description: NF3889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3889_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 20 - 269
Target Start/End: Original strand, 34628562 - 34628811
Alignment:
| Q |
20 |
taattatgttgagtttatattatgttctgttaagaaatggctaattatatttggtttaattttagtatgtcatgtgtgacacaggcagggggaccctatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34628562 |
taattatgttgagtttatattatgttctgttaagaaatggctaattatatttggtttaattttagtatgtcatgtgtgacacaggcagggggaccctatt |
34628661 |
T |
|
| Q |
120 |
accaagtgaagaagggaagatgggatggaaagatatcaatggcatcaagggtagggtcaaacatcccccgtgcaaactcaaccgttgatgagctcatcaa |
219 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34628662 |
atcaagtgaagaagggaagatgggatggaaagatatcaatggcatcaagggtagggtcaaacatcccccgtgcaaactcaaccgttgatgagctcatcaa |
34628761 |
T |
|
| Q |
220 |
aatcttcaattcaaaaggcttaaccatacaggacatggttgctctctctg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34628762 |
aatcttcaattcaaaaggcttaaccatacaggacatggttgctctttctg |
34628811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University